zgc:92429

Ensembl ID:
ENSDARG00000030176
ZFIN ID:
ZDB-GENE-040801-194
Description:
hypothetical protein LOC445063 [Source:RefSeq peptide;Acc:NP_001003457]
Human Orthologue:
ITGB1BP2
Human Description:
integrin beta 1 binding protein (melusin) 2 [Source:HGNC Symbol;Acc:6154]
Mouse Orthologue:
Itgb1bp2
Mouse Description:
integrin beta 1 binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1353420]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30630 Nonsense Mutation detected in F1 DNA During 2018
sa20919 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa30630
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048050 Nonsense 233 387 9 11
ENSDART00000145186 Nonsense 233 281 9 10

The following transcripts of ENSDARG00000030176 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 24898386)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23460138
GRCz11 7 23731295
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTGGTCTGTAGGATAAAAAGAAGGTGGCCTGTCGACATGATTGGCAT[C/T]AGACTGGAAGCCAGGTTGTTGTCACGATCTACGCCAAAAACTGCAATCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20919
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048050 Essential Splice Site 281 387 10 11
ENSDART00000145186   281 281 10 10

The following transcripts of ENSDARG00000030176 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 24898138)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23459890
GRCz11 7 23731047
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGTTCGAAGGCGACAAAGTGTTCCATAAGGACATCCACTTATGGGGG[G/T]TAAGACTGCTGTGCATTCATCACTCCTTAGGATTTAGCAGTGACCAACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link