TRAF2 (2 of 2)

Ensembl ID:
ENSDARG00000030173
Description:
TNF receptor-associated factor 2 [Source:HGNC Symbol;Acc:12032]
Human Orthologue:
TRAF2
Human Description:
TNF receptor-associated factor 2 [Source:HGNC Symbol;Acc:12032]
Mouse Orthologue:
Traf2
Mouse Description:
TNF receptor-associated factor 2 Gene [Source:MGI Symbol;Acc:MGI:101835]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40445 Essential Splice Site Mutation detected in F1 DNA During 2018
sa40444 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40445
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043466 Essential Splice Site 201 502 5 11
Genomic Location (Zv9):
Chromosome 5 (position 30400095)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28161884
GRCz11 5 28762037
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCAATGATTTGTGAAGGCTGTGCCAAGAAAAAAATTCCCAGAGAGAAAG[T/A]AAGTAAATGCTATTTAGGCCATTTACATGTATCAATGTTATGTCACAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40444
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043466 Nonsense 357 502 9 11
Genomic Location (Zv9):
Chromosome 5 (position 30396607)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 28158396
GRCz11 5 28758549
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTAAGATGAGGGAGATGTCTGCTGCCACCTATGATGGTGTGTTTGTATG[G/A]AAGATCTCAGACTTCTCGAAGAAGAGACAGGATGCTGTAGCTGGACGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link