syne2a

Ensembl ID:
ENSDARG00000030107
ZFIN ID:
ZDB-GENE-041001-109
Description:
Novel protein similar to vertebrate spectrin repeat containing, nuclear envelope 2 (SYNE2) [Source:U
Human Orthologue:
SYNE2
Human Description:
spectrin repeat containing, nuclear envelope 2 [Source:HGNC Symbol;Acc:17084]
Mouse Orthologue:
Syne2
Mouse Description:
synaptic nuclear envelope 2 Gene [Source:MGI Symbol;Acc:MGI:2449316]

Alleles

There are 32 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45694 Nonsense Mutation detected in F1 DNA During 2018
sa29341 Nonsense Mutation detected in F1 DNA During 2018
sa752 Nonsense Available for shipment Available now
sa12747 Nonsense Available for shipment Available now
sa37016 Nonsense Mutation detected in F1 DNA During 2018
sa37015 Nonsense Mutation detected in F1 DNA During 2018
sa43424 Nonsense Mutation detected in F1 DNA During 2018
sa23681 Nonsense Available for shipment Available now
sa43423 Nonsense Mutation detected in F1 DNA During 2018
sa10833 Nonsense Available for shipment Available now
sa43422 Nonsense Mutation detected in F1 DNA During 2018
sa23680 Nonsense Available for shipment Available now
sa11385 Nonsense Available for shipment Available now
sa10113 Nonsense Available for shipment Available now
sa32287 Nonsense Available for shipment Available now
sa17499 Essential Splice Site Available for shipment Available now
sa23679 Nonsense Available for shipment Available now
sa9101 Nonsense Mutation detected in F1 DNA During 2018
sa37014 Nonsense Mutation detected in F1 DNA During 2018
sa43421 Nonsense Mutation detected in F1 DNA During 2018
sa43420 Nonsense Mutation detected in F1 DNA During 2018
sa37013 Nonsense Mutation detected in F1 DNA During 2018
sa37012 Essential Splice Site Mutation detected in F1 DNA During 2018
sa23678 Nonsense Available for shipment Available now
sa13943 Essential Splice Site Available for shipment Available now
sa23677 Nonsense Available for shipment Available now
sa23676 Nonsense Available for shipment Available now
sa37011 Nonsense Mutation detected in F1 DNA During 2018
sa11511 Nonsense Available for shipment Available now
sa43419 Essential Splice Site Mutation detected in F1 DNA During 2018
sa5949 Nonsense Mutation detected in F1 DNA During 2018
sa15833 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45694
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027454 Nonsense 29 8864 1 98
ENSDART00000131967   None 426 None 10
ENSDART00000133286   None 1000 None 18

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 21868249)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21896416
GRCz11 20 21796089
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGATGAGAGGGGCGTTCTACTGGACATTGATGACGTTCACTTGCTTTTA[C/T]AAGGTTAGTCTTAACTTTCAGAAAATTATCGGTCTTTGTTTATTTAGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29341
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027454 Nonsense 615 8864 15 98
ENSDART00000131967   None 426 None 10
ENSDART00000133286   None 1000 None 18
Genomic Location (Zv9):
Chromosome 20 (position 21842666)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21870833
GRCz11 20 21770506
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTATGGAGCGTGTGCTGGGTGCATGGGAGTCCTACAAAGACTACCTGTA[T/A]CGGTTACAGGTCTGGCTGGGGCAGGAGAGTCAAACACAGATGCAAGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa752
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027454 Nonsense 819 8864 19 98
ENSDART00000131967   None 426 None 10
ENSDART00000133286   None 1000 None 18

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 21838470)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21866637
GRCz11 20 21766310
KASP Assay ID:
554-0659.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGCACAGAGGCCCAAGAGGTCTGCCAGCACCTAAGCAGCAGGCAGCGT[C/T]GRGGCCACTTGGAGCCACATCTTAGGGCTAAAGTGAGTAGAAATTGGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12747
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027454 Nonsense 988 8864 21 98
ENSDART00000131967   None 426 None 10
ENSDART00000133286   None 1000 None 18

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 21837793)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21865960
GRCz11 20 21765633
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCATGATAAATCTCCCGAAGATCAAAGGAAAGCTAAATGCCAAATACAG[C/T]AAGCAGACCTCAAACAGCCTTTGTTGTCATCCGTTGTTGGCAGGAAGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37016
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027454 Nonsense 1213 8864 21 98
ENSDART00000131967   None 426 None 10
ENSDART00000133286   None 1000 None 18
Genomic Location (Zv9):
Chromosome 20 (position 21837118)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21865285
GRCz11 20 21764958
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCTCTCCAGGTGGTTTCTGTAGACTTAAGCCAAACAAGTGGCTTTAGA[C/T]AATCAGAGGTACAGGTTGTTCATGTAAACACAAGCCCGACCATTGGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37015
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027454 Nonsense 1315 8864 21 98
ENSDART00000131967   None 426 None 10
ENSDART00000133286   None 1000 None 18
Genomic Location (Zv9):
Chromosome 20 (position 21836812)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21864979
GRCz11 20 21764652
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCACCAACACGCCAAGTTCAAACCTTATTAGCACCCTCGAAGCAAAGA[C/T]AAACTGTTCTAGTCAAAAGTTGCAGCTTTACCCAGCCCCATGATGAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43424
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027454 Nonsense 1852 8864 29 98
ENSDART00000131967   None 426 None 10
ENSDART00000133286   None 1000 None 18
Genomic Location (Zv9):
Chromosome 20 (position 21825002)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21853169
GRCz11 20 21752842
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCAGCTGAACGATGAATTAAATGCTCACAGGACGTCAGACCAAAGCTA[C/A]AGTTCAGTGTCCTTCCAGAAAAGCCTTGAACAGGTCAGGGAAGATTCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23681
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027454 Nonsense 1862 8864 29 98
ENSDART00000131967   None 426 None 10
ENSDART00000133286   None 1000 None 18
Genomic Location (Zv9):
Chromosome 20 (position 21824974)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21853141
GRCz11 20 21752814
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGGACGTCAGACCAAAGCTACAGTTCAGTGTCCTTCCAGAAAAGCCTT[G/T]AACAGGTCAGGGAAGATTCGCTTCAGCTGGACACAATGCTGGATGATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43423
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027454 Nonsense 2333 8864 36 98
ENSDART00000131967   None 426 None 10
ENSDART00000133286   None 1000 None 18
Genomic Location (Zv9):
Chromosome 20 (position 21815579)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21843746
GRCz11 20 21743419
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAAGAAAGCATTAGAATTGCCAAAGAGCTTAATATAAAGAAGGGAGAA[C/T]AAACAATGAACCCAAACAAGCCTGTAACTTCTCAGCCTGTCGAAGAGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10833
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027454 Nonsense 3034 8864 37 98
ENSDART00000131967   None 426 None 10
ENSDART00000133286   None 1000 None 18
Genomic Location (Zv9):
Chromosome 20 (position 21808217)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21836384
GRCz11 20 21736057
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTTGCTAAARGTAGKAAAAAGAWCAAGAAATCAGTTGATGCAGTGAAA[A/T]ARGACAATATCAGTAGYTTAAAGCTGAAGGCTTCCACATCTGAACATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43422
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027454 Nonsense 3802 8864 37 98
ENSDART00000131967   None 426 None 10
ENSDART00000133286   None 1000 None 18
Genomic Location (Zv9):
Chromosome 20 (position 21805913)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21834080
GRCz11 20 21733753
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTGAATGTGCTCCTATTGAAGCCACAGAGAGTGTGGTTTTAAAAACA[G/T]AAGACAGTGTACAGTCAAAACATGCAGAGAAATCAATGCCAACAGATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23680
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027454 Nonsense 3876 8864 37 98
ENSDART00000131967   None 426 None 10
ENSDART00000133286   None 1000 None 18
Genomic Location (Zv9):
Chromosome 20 (position 21805691)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21833858
GRCz11 20 21733531
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAAAGGCTCAAGAGAAGACATAAATGCCTATAAAGATGCCAAAACTCAA[C/T]AGAGGAGCTCTGCTGGCACAGAGAAACCTGAAGAACAAGAGCCTAAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11385
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027454 Nonsense 4382 8864 37 98
ENSDART00000131967   None 426 None 10
ENSDART00000133286   None 1000 None 18
Genomic Location (Zv9):
Chromosome 20 (position 21804173)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21832340
GRCz11 20 21732013
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGATATTTTGGGGCTGTTRGAGTTTCAGTGGTTGGAGGTGCTCATRTT[G/T]AAGYCACAGATAGTGTGGYTTTAGSAACARGAGACATTGTGCAGTCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10113
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027454 Nonsense 5074 8864 41 98
ENSDART00000131967   None 426 None 10
ENSDART00000133286   None 1000 None 18
Genomic Location (Zv9):
Chromosome 20 (position 21797924)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21826091
GRCz11 20 21725764
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGAGCTGCAGATCKGGCAGTGTTAACAGAGCGCTGCTTGTACCTGCAT[G/T]AGGTCTCTCAAGCTCTTTTTTCAAKTCCACTGGRAAAGAAAGAGATCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32287
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027454 Nonsense 5667 8864 42 98
ENSDART00000131967   None 426 None 10
ENSDART00000133286   None 1000 None 18
Genomic Location (Zv9):
Chromosome 20 (position 21794014)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21822181
GRCz11 20 21721854
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCCTCCACTGGCTTTAAAAATGACCGAGAGGAGCTCCGCTATATTCAA[C/T]AGATCTTCAGCTCTCTTGCTGAGGGTTTCCAGGCCCGTTTGTCAGAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17499
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027454 Essential Splice Site 5729 8864 42 98
ENSDART00000131967   None 426 None 10
ENSDART00000133286   None 1000 None 18
Genomic Location (Zv9):
Chromosome 20 (position 21793826)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21821993
GRCz11 20 21721666
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGCCAAATTAGAAGCTCARGCTCAATTCCAACTGGAGGCCTTACAGAG[G/T]TTAGTCCTACTCTWTAAAGTGCATGGTTTATTATTATTATTTTTTAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23679
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027454 Nonsense 6326 8864 53 98
ENSDART00000131967 Nonsense 345 426 7 10
ENSDART00000133286   None 1000 None 18
Genomic Location (Zv9):
Chromosome 20 (position 21781091)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21809258
GRCz11 20 21708931
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGTCTTCCAGCAGGGGCAGAGCAAACTCTCACAGTCTTCAGTCGCTCT[C/T]AAGAGCTCCTGCAACCCATCCAAGAGCTCCAGCAGCTCAGTGTGCAGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9101
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027454 Nonsense 6352 8864 54 98
ENSDART00000131967 Nonsense 371 426 8 10
ENSDART00000133286   None 1000 None 18
Genomic Location (Zv9):
Chromosome 20 (position 21779715)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21807882
GRCz11 20 21707555
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTACAAGTTTAAAGACTTAATGAAACTTTTTTTTNNCTAGGCCTCTATTGGA[C/T]ARCCAGCTGAATTGATTCTCCCTTCAGACCAACCCTCAGAAGTGCCGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37014
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027454 Nonsense 6687 8864 58 98
ENSDART00000131967   None 426 None 10
ENSDART00000133286   None 1000 None 18
Genomic Location (Zv9):
Chromosome 20 (position 21774374)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21802541
GRCz11 20 21702214
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACAGCCGTTTACCAGAGCAGCACCCCATCTCAGGAACACACACTTCAT[C/T]AGACAACAGCCGTCAGCAAGTCTGAAGATCAGGAGAGTTTGGTCCAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43421
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027454 Nonsense 6763 8864 60 98
ENSDART00000131967   None 426 None 10
ENSDART00000133286   None 1000 None 18
Genomic Location (Zv9):
Chromosome 20 (position 21771847)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21800014
GRCz11 20 21699687
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTGTTCTGTAAGAATGTGCAGGGCGGCACCTGGATGTTAGTTATTGAC[C/T]AAAAGAAAACAGCGGGACAAAATACCGAGGAGATTCAGAGATGCTGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43420
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027454 Nonsense 6975 8864 63 98
ENSDART00000131967   None 426 None 10
ENSDART00000133286   None 1000 None 18
Genomic Location (Zv9):
Chromosome 20 (position 21766312)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21794479
GRCz11 20 21694152
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCACTGGAAACATCTTCATAATCAGCTACAGCAGAAGATACAGTCTACA[C/T]AGAAAATCAGAATGAATTATGAGAGGTATGGGGAAAATGTAGAATCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37013
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027454 Nonsense 6981 8864 63 98
ENSDART00000131967   None 426 None 10
ENSDART00000133286   None 1000 None 18
Genomic Location (Zv9):
Chromosome 20 (position 21766292)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21794459
GRCz11 20 21694132
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCAGCTACAGCAGAAGATACAGTCTACACAGAAAATCAGAATGAATTA[T/A]GAGAGGTATGGGGAAAATGTAGAATCATTTTAAAAATCTATAATTTCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37012
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027454 Essential Splice Site 6983 8864 63 98
ENSDART00000131967   None 426 None 10
ENSDART00000133286   None 1000 None 18
Genomic Location (Zv9):
Chromosome 20 (position 21766285)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21794452
GRCz11 20 21694125
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAGCAGAAGATACAGTCTACACAGAAAATCAGAATGAATTATGAGAGG[T/C]ATGGGGAAAATGTAGAATCATTTTAAAAATCTATAATTTCCCTTCACCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23678
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027454 Nonsense 7083 8864 65 98
ENSDART00000131967   None 426 None 10
ENSDART00000133286   None 1000 None 18
Genomic Location (Zv9):
Chromosome 20 (position 21765767)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21793934
GRCz11 20 21693607
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGGAATGGACAAAACTGACCAGCGTGCTGCCCGCTCTTCAACAGACA[C/T]AGCAAGAAGTATTACTAATGTCTCATCTTCACTCCCTCTGTCACTTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13943
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027454 Essential Splice Site 7086 8864 66 98
ENSDART00000131967   None 426 None 10
ENSDART00000133286   None 1000 None 18
Genomic Location (Zv9):
Chromosome 20 (position 21765658)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21793825
GRCz11 20 21693498
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAGCTTCATCAAACAGATATTGCTAYAGTAAGCGTCTCTTTATCTTCTT[A/G]GCTGTTGGAAGGCCAGTCAGACAGTCAGATCTTGRCTGATTTGTCTTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23677
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027454 Nonsense 7208 8864 68 98
ENSDART00000131967   None 426 None 10
ENSDART00000133286   None 1000 None 18
Genomic Location (Zv9):
Chromosome 20 (position 21763345)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21791512
GRCz11 20 21691185
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGTCTCCAGATACATGATGTGGAGGACCAATGGCAAGCCTGTGGAGAC[A/T]GAGAAAAGCTATTGCGCTGTATACACAGCTGGATTTCTCAGCATATGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23676
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027454 Nonsense 7465 8864 72 98
ENSDART00000131967   None 426 None 10
ENSDART00000133286   None 1000 None 18
Genomic Location (Zv9):
Chromosome 20 (position 21758941)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21787108
GRCz11 20 21686781
KASP Assay ID:
2261-4192.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGATAGAGAAGAAAACACTGTAGAAATGCTCATCAGCAGGATGCAGTA[C/A]ATTAGTGTGAGTACAAACATATTACAGGTGCAAACGTTTTTATGGTATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37011
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027454 Nonsense 7633 8864 76 98
ENSDART00000131967   None 426 None 10
ENSDART00000133286   None 1000 None 18
Genomic Location (Zv9):
Chromosome 20 (position 21755088)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21783255
GRCz11 20 21682928
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTAGGAAGATGTATGGAGAGCTGCTGCGTGATCAGAACTTCCAGCAG[A/T]AGTGCCAGTGCTGGATGGAGCTCCTGGACAAAATGGAGACTGATTTAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11511
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027454 Nonsense 8058 8864 84 98
ENSDART00000131967   None 426 None 10
ENSDART00000133286 Nonsense 194 1000 4 18
Genomic Location (Zv9):
Chromosome 20 (position 21732607)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21760774
GRCz11 20 21660447
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTCTRTTTCAGGGKGAAGAAGCTGACCGAGACTTTGGTGACAGTACAR[C/T]AGTTGGATAAGAACATGAATAACCTTCGCTCTTGGCTYACGCGCATTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43419
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027454 Essential Splice Site 8385 8864 90 98
ENSDART00000131967   None 426 None 10
ENSDART00000133286 Essential Splice Site 521 1000 10 18
Genomic Location (Zv9):
Chromosome 20 (position 21725326)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21753493
GRCz11 20 21653166
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGATTCAGATAATATGAGTATGAGTAACAATGTTTTTCTTCTGTAACA[G/T]TTGCAGGAGCATCCAGACGTGTATGATGGCGAGCGGTCGAGAGAGACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5949
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027454 Nonsense 8395 8864 90 98
ENSDART00000131967   None 426 None 10
ENSDART00000133286 Nonsense 531 1000 10 18
Genomic Location (Zv9):
Chromosome 20 (position 21725295)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21753462
GRCz11 20 21653135
KASP Assay ID:
554-3913.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTTTTTCTTCTGTAACAGTTGCAGGAGCATCCAGACGTGTATGATGGC[G/T]AGCGGTCGAGAGAGACACAGAGTCCTCCTTCCTCTAGTCAGCCCTCCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15833
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027454 Nonsense 8497 8864 92 98
ENSDART00000131967   None 426 None 10
ENSDART00000133286 Nonsense 633 1000 12 18
Genomic Location (Zv9):
Chromosome 20 (position 21720946)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21749113
GRCz11 20 21648786
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGMACTTGAGTGAAAGGTGATTGTGATGTGACNNNNGTNNACTGTATGTGAAGGTC[C/T]AGCTGATGTCTGAATGCAGCGGCAKCATCAAGAGTGTGAAGAGGRTTTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link