si:dkey-57b6.3

Ensembl ID:
ENSDARG00000030104
ZFIN ID:
ZDB-GENE-081104-509
Description:
SH3-domain binding protein 4 [Source:RefSeq peptide;Acc:NP_001116767]
Human Orthologue:
SH3BP4
Human Description:
SH3-domain binding protein 4 [Source:HGNC Symbol;Acc:10826]
Mouse Orthologue:
Sh3bp4
Mouse Description:
SH3-domain binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:2138297]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34634 Nonsense Mutation detected in F1 DNA During 2018
sa41412 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34634
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101685 Nonsense 48 960 2 4

The following transcripts of ENSDARG00000030104 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 24416254)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23572040
GRCz11 9 23382909
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTCATTTGTTTATTTATCAATCAACAGTCCCTTCACCTAGTTCTTTA[C/T]GACTGGATGCTACTGCCTCATTTGGAGCTGCCAGGGAAGTGATTGCCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41412
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101685 Nonsense 738 960 2 4

The following transcripts of ENSDARG00000030104 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 24414183)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23569969
GRCz11 9 23380838
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGAAACCTGTTAATTATAAAGGGTCAGATCTTACGACTACAGTGCTTT[T/A]AGAGCAGATCCTGAAGCCCTGCATGTGTCTGACGTACATCTATGCATCGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link