sdcbp

Ensembl ID:
ENSDARG00000030097
ZFIN ID:
ZDB-GENE-081104-57
Description:
si:dkey-235k4.1 [Source:RefSeq peptide;Acc:NP_999963]
Human Orthologue:
SDCBP
Human Description:
syndecan binding protein (syntenin) [Source:HGNC Symbol;Acc:10662]
Mouse Orthologue:
Sdcbp
Mouse Description:
syndecan binding protein Gene [Source:MGI Symbol;Acc:MGI:1337026]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44676 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44676
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050077 Nonsense 185 307 6 9
ENSDART00000123573 Nonsense 185 307 5 8
Genomic Location (Zv9):
Chromosome 7 (position 59506970)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 57959579
GRCz11 7 58262019
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGATCAATGGCAAATCATGTGCAGGCTGGAATAGCGATTATGCACAC[A/T]AGGTGCTCAAGAACTCCAATCCAGAGAGAATTACTTTGGCTGTGCGAGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link