si:dkeyp-110c7.1

Ensembl ID:
ENSDARG00000030087
ZFIN ID:
ZDB-GENE-070705-529
Description:
si:dkeyp-110c7.1 [Source:RefSeq peptide;Acc:NP_001122267]
Human Orthologue:
NFKBIB
Human Description:
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta [Source:HGNC Symb
Mouse Orthologue:
Nfkbib
Mouse Description:
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta Gene [Source:MGI

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1776 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1776
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045036 Nonsense 221 394 3 6
Genomic Location (Zv9):
Chromosome 5 (position 38633901)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36433585
GRCz11 5 37033738
KASP Assay ID:
554-1769.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCTCTGCATTTAGCAGTCATTGTCGACAGCAGTGAGTGTGTTCGAGCGT[T/A]ATTGTGGAGCGGAGCCAGTGCAGAGATCCAAGAGAGGGGTGGAAACACAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link