zgc:65887

Ensembl ID:
ENSDARG00000030078
ZFIN ID:
ZDB-GENE-040426-1459
Description:
hypothetical protein LOC393547 [Source:RefSeq peptide;Acc:NP_956869]
Human Orthologue:
GLIPR1
Human Description:
GLI pathogenesis-related 1 [Source:HGNC Symbol;Acc:17001]
Mouse Orthologue:
Glipr1
Mouse Description:
GLI pathogenesis-related 1 (glioma) Gene [Source:MGI Symbol;Acc:MGI:1920940]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36569 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36569
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041429 Nonsense 208 247 5 5
Genomic Location (Zv9):
Chromosome 18 (position 6817673)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7395363
GRCz11 18 7354298
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACATCTTGCTCACATATGCTGTAACATCTCTCTTTACAGGATATGATTG[G/A]TTCCCTGGCTGGGATTATGGTCCGCCCTCTTCAGCCCACAGTGTTTCTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link