
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
eef1db
- Ensembl ID:
- ENSDARG00000030053
- ZFIN ID:
- ZDB-GENE-030131-6544
- Description:
- elongation factor-1, delta, b isoform 2 [Source:RefSeq peptide;Acc:NP_001025318]
- Human Orthologue:
- EEF1D
- Human Description:
- eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) [Source:HGNC
- Mouse Orthologue:
- Eef1d
- Mouse Description:
- eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) Gene [Source:
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa37176 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa6656 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa37177 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa37176
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000028648 | Essential Splice Site | 318 | 578 | None | 8 |
ENSDART00000042704 | Essential Splice Site | 38 | 298 | None | 8 |
ENSDART00000047264 | Essential Splice Site | 318 | 554 | None | 7 |
ENSDART00000110777 | Essential Splice Site | 38 | 274 | None | 7 |
ENSDART00000131647 | Essential Splice Site | 38 | 298 | None | 7 |
ENSDART00000145230 | Essential Splice Site | 318 | 554 | None | 9 |
- Genomic Location (Zv9):
- Chromosome 20 (position 52903269)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 52756116 GRCz11 20 52561732 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGAACGACGGTTTTACGAACAGATGAACGGACCCACAAAGCCCAAACAGG[T/C]AATGAATACCAGGGGGATATACAGTCGAAGACAAAATTATTATCCTCTTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6656
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000028648 | Nonsense | 479 | 578 | 6 | 8 |
ENSDART00000042704 | Nonsense | 199 | 298 | 6 | 8 |
ENSDART00000047264 | Nonsense | 455 | 554 | 5 | 7 |
ENSDART00000110777 | Nonsense | 175 | 274 | 5 | 7 |
ENSDART00000131647 | Nonsense | 199 | 298 | 5 | 7 |
ENSDART00000145230 | Nonsense | 455 | 554 | 7 | 9 |
- Genomic Location (Zv9):
- Chromosome 20 (position 52916551)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 52769398 GRCz11 20 52575014 - KASP Assay ID:
- 554-4718.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAGGAGGATGAAGAGGCAGAGAGACTCAAAGAGCAGCGGCTGCAAGAATA[C/A]GCCGCRAAAAAAGCCAAAAAACCTGCCCTCATCGCAAAATCATCCATCCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37177
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000028648 | Essential Splice Site | 501 | 578 | 6 | 8 |
ENSDART00000042704 | Essential Splice Site | 221 | 298 | 6 | 8 |
ENSDART00000047264 | Essential Splice Site | 477 | 554 | 5 | 7 |
ENSDART00000110777 | Essential Splice Site | 197 | 274 | 5 | 7 |
ENSDART00000131647 | Essential Splice Site | 221 | 298 | 5 | 7 |
ENSDART00000145230 | Essential Splice Site | 477 | 554 | 7 | 9 |
- Genomic Location (Zv9):
- Chromosome 20 (position 52916619)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 52769466 GRCz11 20 52575082 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAAACCTGCCCTCATCGCAAAATCATCCATCCTGTTAGACGTCAAACCTG[T/A]GAGTGATCCCCTTCAGTTTCACACACACACACACACACACACACACACAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: