zgc:158225

Ensembl ID:
ENSDARG00000030006
ZFIN ID:
ZDB-GENE-070112-1492
Description:
solute carrier family 6 (neurotransmitter transporter, L-proline), member 7 [Source:RefSeq peptide;
Human Orthologue:
SLC6A7
Human Description:
solute carrier family 6 (neurotransmitter transporter, L-proline), member 7 [Source:HGNC Symbol;Acc:
Mouse Orthologue:
Slc6a7
Mouse Description:
solute carrier family 6 (neurotransmitter transporter, L-proline), member 7 Gene [Source:MGI Symbol;

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43675 Essential Splice Site Mutation detected in F1 DNA During 2018
sa3130 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa43675
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100942 Essential Splice Site 351 537 11 15
ENSDART00000139486 Essential Splice Site 466 652 11 15
Genomic Location (Zv9):
Chromosome 21 (position 29581738)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30781989
GRCz11 21 30818684
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGCTCTGCTTCTCTTTCTATCTGATGGGCCTGTTGCTCATCACTGAC[G/A]TAAGATTTTAGTCCTTTGTGTTTATAAATACACGTACACAGATGTCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3130
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100942 Nonsense 531 537 15 15
ENSDART00000139486 Nonsense 646 652 15 15
Genomic Location (Zv9):
Chromosome 21 (position 29591943)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 30792194
GRCz11 21 30828889
KASP Assay ID:
554-3295.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCCTTTCACAGTTAACCTGACTGAAGCCGACTACACCGGCATGAACTG[G/A]GAGGGCATCAGCGAGGCGTAGCGCSGCCACTAATGTTGAGTACTGGAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link