zgc:153032

Ensembl ID:
ENSDARG00000030004
ZFIN ID:
ZDB-GENE-060929-744
Description:
ERO1-like protein beta [Source:RefSeq peptide;Acc:NP_001070106]
Human Orthologue:
ERO1LB
Human Description:
ERO1-like beta (S. cerevisiae) [Source:HGNC Symbol;Acc:14355]
Mouse Orthologue:
Ero1lb
Mouse Description:
ERO1-like beta (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1914725]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41923 Nonsense Mutation detected in F1 DNA During 2018
sa31848 Nonsense Available for shipment Available now
sa8694 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41923
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049448 Nonsense 23 488 1 16
ENSDART00000098899   None 459 None 16
Genomic Location (Zv9):
Chromosome 11 (position 46609222)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 44240779
GRCz11 11 44502721
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCCACGGGCTCGTGATATTAATGAGTTTAATCTGCGGTTATTTCTGCT[C/A]GGGATGGTTTCAAAACAACGCGAAGAGCAAAAGCACACAGAAGGAACCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31848
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049448 Nonsense 211 488 7 16
ENSDART00000098899 Nonsense 182 459 7 16
Genomic Location (Zv9):
Chromosome 11 (position 46597683)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 44252237
GRCz11 11 44514179
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATCAGAGTATGTGGATCTGCTCCTGAACCCGGAGCGATACACCGGATA[T/G]AAAGGCCCGTCTGCCTGGAGAGTCTGGAACAGCATTTATGAGGAAAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8694
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049448 Nonsense 224 488 7 16
ENSDART00000098899 Nonsense 195 459 7 16
Genomic Location (Zv9):
Chromosome 11 (position 46597644)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 44252276
GRCz11 11 44514218
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACACCGGATATAAAGGCCCGTCYGCCTGGAGAGTCTGGAACAGCATTTA[T/A]GAGGAAAACTGCTTCAAGTGAGAAACACGCMTAACACACACANNTTATATAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link