zgc:85843

Ensembl ID:
ENSDARG00000029982
ZFIN ID:
ZDB-GENE-040426-2362
Description:
transmembrane 6 superfamily member 1 [Source:RefSeq peptide;Acc:NP_998109]
Human Orthologues:
TM6SF1, TM6SF2
Human Descriptions:
transmembrane 6 superfamily member 1 [Source:HGNC Symbol;Acc:11860]
transmembrane 6 superfamily member 2 [Source:HGNC Symbol;Acc:11861]
Mouse Orthologues:
Tm6sf1, Tm6sf2
Mouse Descriptions:
transmembrane 6 superfamily member 1 Gene [Source:MGI Symbol;Acc:MGI:1933209]
transmembrane 6 superfamily member 2 Gene [Source:MGI Symbol;Acc:MGI:1933210]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32557 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32557
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050824 Nonsense 323 342 10 10
Genomic Location (Zv9):
Chromosome Zv9_scaffold3557 (position 8143)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 57155170
GRCz11 2 56910353
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGACGGTGGCGCTGCCCGTCCTGCTCGCCCTGCGCTGTTACGCCAAA[C/T]AAAGCTTCTTCATCAGAGTCCATCCAGAAGAACAGACCCGCAACGGCAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link