
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:110741
- Ensembl ID:
- ENSDARG00000029975
- ZFIN ID:
- ZDB-GENE-050306-53
- Description:
- hypothetical protein LOC503769 [Source:RefSeq peptide;Acc:NP_001013365]
- Human Orthologue:
- C4orf29
- Human Description:
- chromosome 4 open reading frame 29 [Source:HGNC Symbol;Acc:26111]
- Mouse Orthologue:
- 3110057O12Rik
- Mouse Description:
- RIKEN cDNA 3110057O12 gene Gene [Source:MGI Symbol;Acc:MGI:1915468]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa6354 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa6354
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000042486 | Essential Splice Site | 93 | 454 | 4 | 14 |
- Genomic Location (Zv9):
- Chromosome 14 (position 47496922)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 44871174 GRCz11 14 50019414 - KASP Assay ID:
- 554-4432.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGGAGCACTTTGTCCCGGGCATCCTGCCAGCCGAATCCGTCAAAGCCCGG[T/C]AACCACAACACATCAGACACAAACACTTCATGCAAACGTGAGGGATTAAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: