zgc:110741

Ensembl ID:
ENSDARG00000029975
ZFIN ID:
ZDB-GENE-050306-53
Description:
hypothetical protein LOC503769 [Source:RefSeq peptide;Acc:NP_001013365]
Human Orthologue:
C4orf29
Human Description:
chromosome 4 open reading frame 29 [Source:HGNC Symbol;Acc:26111]
Mouse Orthologue:
3110057O12Rik
Mouse Description:
RIKEN cDNA 3110057O12 gene Gene [Source:MGI Symbol;Acc:MGI:1915468]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6354 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6354
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042486 Essential Splice Site 93 454 4 14
Genomic Location (Zv9):
Chromosome 14 (position 47496922)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 44871174
GRCz11 14 50019414
KASP Assay ID:
554-4432.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGCACTTTGTCCCGGGCATCCTGCCAGCCGAATCCGTCAAAGCCCGG[T/C]AACCACAACACATCAGACACAAACACTTCATGCAAACGTGAGGGATTAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link