
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
glb1l
- Ensembl ID:
- ENSDARG00000029955
- ZFIN ID:
- ZDB-GENE-050309-196
- Description:
- beta-galactosidase-1-like protein [Source:RefSeq peptide;Acc:NP_001116328]
- Human Orthologue:
- GLB1L
- Human Description:
- galactosidase, beta 1-like [Source:HGNC Symbol;Acc:28129]
- Mouse Orthologue:
- Glb1l
- Mouse Description:
- galactosidase, beta 1-like Gene [Source:MGI Symbol;Acc:MGI:1921827]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa2491 | Essential Splice Site | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa2491
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000047191 | Essential Splice Site | 408 | 629 | 12 | 16 |
- Genomic Location (Zv9):
- Chromosome 9 (position 13137478)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 12890043 GRCz11 9 12861246 - KASP Assay ID:
- 554-2780.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAGGTCCAGTACGATCTCAATACCCCTTGACATTTGAGGAGATTAAACAA[G/A]TTAGTATATTTAAAATGAGCGTAATTGAAGAGTTCCGATGCAAAAACCTC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: