
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ampd2
- Ensembl ID:
- ENSDARG00000029952
- ZFIN ID:
- ZDB-GENE-070713-5
- Description:
- Adenosine monophosphate deaminase 2 (Isoform L) [Source:UniProtKB/TrEMBL;Acc:B8JIS2]
- Human Orthologue:
- AMPD2
- Human Description:
- adenosine monophosphate deaminase 2 [Source:HGNC Symbol;Acc:469]
- Mouse Orthologue:
- Ampd2
- Mouse Description:
- adenosine monophosphate deaminase 2 Gene [Source:MGI Symbol;Acc:MGI:88016]
Alleles
There are 6 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa2452 | Nonsense | F2 line generated | During 2018 |
sa21296 | Nonsense | Available for shipment | Available now |
sa16131 | Nonsense | Available for shipment | Available now |
sa10749 | Essential Splice Site | Available for shipment | Available now |
sa872 | Nonsense | Available for shipment | Available now |
sa7613 | Missense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa2452
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000045798 | Nonsense | 64 | 230 | 2 | 6 |
ENSDART00000093090 | Nonsense | 40 | 793 | 1 | 17 |
ENSDART00000121932 | Nonsense | 64 | 334 | 2 | 9 |
ENSDART00000143554 | Nonsense | 6 | 756 | 2 | 18 |
- Genomic Location (Zv9):
- Chromosome 8 (position 26120861)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 25248779 GRCz11 8 25267918 - KASP Assay ID:
- 554-3166.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TAACCAAGCAYGGCCACATTGACCTACGCACCTCCATGGATGGCAAATAC[A/T]AAGAGATTGCAGAGGTAAACAAAGCACAAATCACAACACCGACTCTTGAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21296
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000045798 | Nonsense | 120 | 230 | 4 | 6 |
ENSDART00000093090 | Nonsense | 96 | 793 | 3 | 17 |
ENSDART00000121932 | Nonsense | 120 | 334 | 4 | 9 |
ENSDART00000143554 | Nonsense | 62 | 756 | 4 | 18 |
- Genomic Location (Zv9):
- Chromosome 8 (position 26123658)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 25251576 GRCz11 8 25270715 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGTTAATTAAATGCTTATTCTCTTGAGGTTTGAGCCTGATATCCTTCTA[C/T]GAGCCAAACAGGACTTCATGAAAACAGACAGCGCTACGGACCTGGAGTGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16131
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000045798 | Nonsense | 148 | 230 | 5 | 6 |
ENSDART00000093090 | Nonsense | 124 | 793 | 4 | 17 |
ENSDART00000121932 | Nonsense | 148 | 334 | 5 | 9 |
ENSDART00000143554 | Nonsense | 90 | 756 | 5 | 18 |
- Genomic Location (Zv9):
- Chromosome 8 (position 26124472)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 25252390 GRCz11 8 25271529 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTTTTTTTCAGGTATATGAAAGAACAGAGCCAGACACCCATAGAAAACTA[T/A]CCCGAGAGAGAGCTYATCCCRGAGAGAGAGTACCAGAGAGTCACTATCTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10749
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000045798 | None | 230 | None | 6 | |
ENSDART00000093090 | Essential Splice Site | 590 | 793 | 14 | 17 |
ENSDART00000121932 | None | 334 | None | 9 | |
ENSDART00000143554 | Essential Splice Site | 553 | 756 | 15 | 18 |
- Genomic Location (Zv9):
- Chromosome 8 (position 26136682)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 25264600 GRCz11 8 25283739 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGTTTAGATMACTTGAGGATGAGTAAACTGCATTATTTATGTCTCTCAAC[A/T]GGCAAAGAAACATGAATTCGTTCGTGTTRCGYCCTCACTGTGGAGAAGCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa872
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000045798 | None | 230 | None | 6 | |
ENSDART00000093090 | Nonsense | 636 | 793 | 15 | 17 |
ENSDART00000121932 | None | 334 | None | 9 | |
ENSDART00000143554 | Nonsense | 599 | 756 | 16 | 18 |
- Genomic Location (Zv9):
- Chromosome 8 (position 26141845)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 25269763 GRCz11 8 25288902 - KASP Assay ID:
- 554-0774.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTGTTGAGTGATATGTTGCTGTATTTCCCACAGGCTCCTGTACTGCAGTA[T/A]CTGTATTATCTGGCTCAGATTGGCATTGCTATGTCGCCGCTCAGCAACAA
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa7613
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000045798 | None | 230 | None | 6 | |
ENSDART00000093090 | Missense | 730 | 793 | 17 | 17 |
ENSDART00000121932 | None | 334 | None | 9 | |
ENSDART00000143554 | Missense | 693 | 756 | 18 | 18 |
- Genomic Location (Zv9):
- Chromosome 8 (position 26144192)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 25272110 GRCz11 8 25291249 - KASP Assay ID:
- 554-4216.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCGCATTTATCTGACCTATTCAAATGTCTTCTGTGAAGGTGAAAAGCTAC[T/C]GGTTGGGGCCGCATTAYATAAAAGAGGGACAAGAGGGCAATGACAWCMGA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Major depressive disorder: Genome-wide association study of recurrent early-onset major depressive disorder. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: