zgc:136263

Ensembl ID:
ENSDARG00000029944
ZFIN ID:
ZDB-GENE-060421-5714
Description:
UPF0419 protein C12orf48 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q1RMA6]
Human Orthologue:
C12orf48
Human Description:
chromosome 12 open reading frame 48 [Source:HGNC Symbol;Acc:26074]
Mouse Orthologue:
4930547N16Rik
Mouse Description:
RIKEN cDNA 4930547N16 gene Gene [Source:MGI Symbol;Acc:MGI:1922567]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33442 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33442
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041529 Nonsense 324 568 8 11
ENSDART00000134467 Nonsense 324 568 8 11
Genomic Location (Zv9):
Chromosome 4 (position 16413050)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 17355890
GRCz11 4 17344866
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTACCATGCTTATTATTAGTAAGACATGAGATGTTTACTTTATAGCCC[A/T]AAGCGTATGCTATTAACCATGCCACCGCCTATGGAGGACGAGAGACGGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Identification of 15 loci influencing height in a Korean population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link