si:dkey-22i16.2

Ensembl ID:
ENSDARG00000029898
ZFIN ID:
ZDB-GENE-090312-66
Description:
hypothetical protein LOC100001558 [Source:RefSeq peptide;Acc:NP_001139095]
Human Orthologue:
CNGA1
Human Description:
cyclic nucleotide gated channel alpha 1 [Source:HGNC Symbol;Acc:2148]
Mouse Orthologue:
Cnga1
Mouse Description:
cyclic nucleotide gated channel alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88436]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14137 Essential Splice Site Available for shipment Available now
sa18298 Nonsense Available for shipment Available now
sa4861 Nonsense F2 line generated During 2018
sa6600 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa14137
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048225 Essential Splice Site 10 547 None 3
ENSDART00000134649 Essential Splice Site 160 697 None 7
Genomic Location (Zv9):
Chromosome 1 (position 44279224)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 43195540
GRCz11 1 43896704
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATAATCACATTCCCTGTCATGTACAATTGGACAGTTATAATTGCACGG[T/C]AATAATCTGATGTTCATAAGATGAAGAACAYAAATAGAATACAWAAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18298
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048225 Nonsense 35 547 2 3
ENSDART00000134649 Nonsense 185 697 6 7
Genomic Location (Zv9):
Chromosome 1 (position 44278989)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 43195305
GRCz11 1 43896469
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATATCTACTGACGTGGTTCCTCCTGGACTACACCTCTGACCTGCTTTA[C/A]TTGGCTGAYATGGCATTCRGAGCACGAACAGRTACTRTACRTCACTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4861
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048225 Nonsense 87 547 3 3
ENSDART00000134649 Nonsense 237 697 7 7
Genomic Location (Zv9):
Chromosome 1 (position 44278429)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 43194745
GRCz11 1 43895909
KASP Assay ID:
554-3541.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGCCTCGATGTCATCTCTATGCTACCCACAGACATCTTTTACTTTATTT[T/A]GGGGTTGGACTACCCAGAAATCCGCATAAACAAGTTGCTCCGGCTGAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6600
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048225 Nonsense 179 547 3 3
ENSDART00000134649 Nonsense 329 697 7 7
Genomic Location (Zv9):
Chromosome 1 (position 44278152)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 43194468
GRCz11 1 43895632
KASP Assay ID:
554-5153.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCCTGAGTTTGGAGAGCTCATGCGGAAATATTCCTTCAGCCTCTACTG[G/A]TCCACACTTACTCTCACCACCATTGGAGAAACGCCATCYCCAGAGCTCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link