si:dkeyp-86f7.4

Ensembl ID:
ENSDARG00000029890
ZFIN ID:
ZDB-GENE-091204-252
Human Orthologues:
RNF128, RNF133, RNF148
Human Descriptions:
ring finger protein 128 [Source:HGNC Symbol;Acc:21153]
ring finger protein 133 [Source:HGNC Symbol;Acc:21154]
ring finger protein 148 [Source:HGNC Symbol;Acc:22411]
Mouse Orthologues:
Rnf128, Rnf133, Rnf148
Mouse Descriptions:
ring finger protein 128 Gene [Source:MGI Symbol;Acc:MGI:1914139]
ring finger protein 133 Gene [Source:MGI Symbol;Acc:MGI:2677436]
ring finger protein 148 Gene [Source:MGI Symbol;Acc:MGI:1918550]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22429 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22429
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042727 Nonsense 274 319 4 5
Genomic Location (Zv9):
Chromosome 14 (position 9617893)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 9139733
GRCz11 14 9445747
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATGACACTGGCTGTGTGGTTTGCACTGACTCTTACCAACGTGGTGAA[C/T]AAGTCACAGTTTTACCCTGCAGGTGCAGTATAAAGTTAACATATGATTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link