zgc:85644

Ensembl ID:
ENSDARG00000029795
ZFIN ID:
ZDB-GENE-040426-2556
Description:
Uncharacterized protein C1orf93 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6NV24]
Human Orthologue:
C1orf93
Human Description:
chromosome 1 open reading frame 93 [Source:HGNC Symbol;Acc:28390]
Mouse Orthologue:
2810405K02Rik
Mouse Description:
RIKEN cDNA 2810405K02 gene Gene [Source:MGI Symbol;Acc:MGI:1913719]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13891 Nonsense Available for shipment Available now
sa21971 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13891
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047412 Nonsense 92 201 3 8
ENSDART00000112140 Nonsense 92 201 3 7
ENSDART00000147264 Nonsense 92 201 3 7

The following transcripts of ENSDARG00000029795 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 42118366)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 40378147
GRCz11 11 40642292
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTCATCTTCCTGATTCTGTGAATCTTTAACCTTTNGTTTTAGACATCTA[C/A]ATTGAWGAGATGAAACAGTGTTACAAAGATTTAGGCTTTAAAAGGTAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21971
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047412   None 201 None 8
ENSDART00000112140 Nonsense 194 201 7 7
ENSDART00000147264   None 201 None 7

The following transcripts of ENSDARG00000029795 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 42112740)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 40372521
GRCz11 11 40636666
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTCAGTAGTTACAGATTTTCAACATTTTTCAAAATATCTTCTTTTGTG[T/A]TCAACAGTTGTGTGTGACAAGTAAAGGTTGAGTAATTGAAGGCAGATTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ulcerative colitis: Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link