zgc:92202

Ensembl ID:
ENSDARG00000029783
ZFIN ID:
ZDB-GENE-040718-386
Description:
death effector domain-containing protein [Source:RefSeq peptide;Acc:NP_001002639]
Human Orthologue:
DEDD
Human Description:
death effector domain containing [Source:HGNC Symbol;Acc:2755]
Mouse Orthologue:
Dedd
Mouse Description:
death effector domain-containing Gene [Source:MGI Symbol;Acc:MGI:1333874]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa930 Nonsense F2 line generated During 2018
sa2414 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa930
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042867 Nonsense 4 404 2 5
ENSDART00000128377 Nonsense 4 404 1 4
ENSDART00000140948   None 167 None 3
Genomic Location (Zv9):
Chromosome 8 (position 14593251)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14038595
GRCz11 8 14076300
KASP Assay ID:
554-0835.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTCCATCCMCCTCACCCGTCATCCGCCTAGCGAAGAGTGATGACCTCA[C/T]AGCAGCATGGGAATGCCAACCCTGCCCTCCTCTCGCCACAGAACTCCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2414
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042867 Nonsense 227 404 4 5
ENSDART00000128377 Nonsense 227 404 3 4
ENSDART00000140948   None 167 None 3
Genomic Location (Zv9):
Chromosome 8 (position 14584500)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14029844
GRCz11 8 14067549
KASP Assay ID:
554-2438.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTCATGGTAGTGATTTTTATTATGTTTTRTTTGCCAGGACCCCAGCCCT[T/G]AATATGCTGTCCTCCATCAGGACCCCAGGTATGTCCACCACGTGCTAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link