WAPAL (1 of 2)

Ensembl ID:
ENSDARG00000029768
Description:
wings apart-like homolog (Drosophila) [Source:HGNC Symbol;Acc:23293]
Human Orthologue:
WAPAL
Human Description:
wings apart-like homolog (Drosophila) [Source:HGNC Symbol;Acc:23293]
Mouse Orthologue:
Wapal
Mouse Description:
wings apart-like homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2675859]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19030 Nonsense Mutation detected in F1 DNA During 2018
sa9959 Nonsense Available for shipment Available now
sa13582 Essential Splice Site Available for shipment Available now
sa35225 Nonsense Mutation detected in F1 DNA During 2018
sa35226 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa19030
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032195 Nonsense 242 1168 2 19
ENSDART00000032195 Nonsense 242 1168 2 19
Genomic Location (Zv9):
Chromosome 12 (position 12785448)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 11641101
GRCz11 12 11679404
KASP Assay ID:
2260-5075.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCATCTTCTATGTTGTGGGCATCCAGTAGTTACAGTCACAGCAACATT[C/T]AGGGCAAATCCTCCACTGAGACTCGGTTAGACAACTTCCACCAAGGGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9959
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032195 Nonsense 242 1168 2 19
ENSDART00000032195 Nonsense 242 1168 2 19
Genomic Location (Zv9):
Chromosome 12 (position 12785448)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 11641101
GRCz11 12 11679404
KASP Assay ID:
2260-5075.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCATCTTCTATGTTGTGGGCATCCAGTAGTTACAGTCACAGCAMCATT[C/T]AGGGCAAATCCTCCACTGAGACTCGGTTAGACAACTTCCACCAAGGGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13582
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032195 Essential Splice Site 384 1168 3 19
Genomic Location (Zv9):
Chromosome 12 (position 12789992)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 11645645
GRCz11 12 11683948
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTATGAAAGTCTRACTGTNNNNNNNNTTTTTTKTTTTTTTTTTCTGTGGGGTTTCTA[G/T]TCGATCTCGACCCACGCAGAGCAAAATGAAGAGCAGTAAGCTGGAGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35225
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032195 Nonsense 432 1168 3 19
Genomic Location (Zv9):
Chromosome 12 (position 12790136)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 11645789
GRCz11 12 11684092
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTCAGGAAGCTCGAGCTACAGGATCAAATACTTCGGCTTTGATGACT[T/A]GAGCGAGAGTGACAGTGAAGAAGAGGAGGGTTCCTCTCACAGAAGGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35226
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032195 Nonsense 664 1168 8 19
Genomic Location (Zv9):
Chromosome 12 (position 12825358)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 11681011
GRCz11 12 11719314
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTGTAGACCACCTTATTCTTCTTGCTTCTGTTTGCAGTGTTATTAGTT[T/A]GGCCACGCGTTGCGCAATGCCCAGTTTTAGAATGCACCTGAGGGCTCGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link