
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
mpp6b
- Ensembl ID:
- ENSDARG00000029761
- ZFIN ID:
- ZDB-GENE-040426-775
- Description:
- MAGUK p55 subfamily member 6 [Source:RefSeq peptide;Acc:NP_001038242]
- Human Orthologue:
- MPP6
- Human Description:
- membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6) [Source:HGNC Symbol;Acc:18167]
- Mouse Orthologue:
- Mpp6
- Mouse Description:
- membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6) Gene [Source:MGI Symbol;Acc:MGI:192
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa18546 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa18546
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000043924 | Essential Splice Site | 294 | 539 | 8 | 13 |
ENSDART00000126173 | Essential Splice Site | 294 | 539 | 6 | 11 |
The following transcripts of ENSDARG00000029761 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 19 (position 20556780)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 20490160 GRCz11 19 20074483 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTAGAGGAAAAGAGGAAAGCATTTGTTCCTAGAGACCTGGATGGAGCAGG[T/C]AATGCTCGTCAACACACTGCGRTCACCAAAACAGAAAAGATTTTTGATAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: