zgc:111946

Ensembl ID:
ENSDARG00000029751
ZFIN ID:
ZDB-GENE-050522-112
Description:
hypothetical protein LOC553658 [Source:RefSeq peptide;Acc:NP_001018467]
Human Orthologue:
C10orf26
Human Description:
chromosome 10 open reading frame 26 [Source:HGNC Symbol;Acc:23510]
Mouse Orthologue:
D19Wsu162e
Mouse Description:
DNA segment, Chr 19, Wayne State University 162, expressed Gene [Source:MGI Symbol;Acc:MGI:107577]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17840 Nonsense Available for shipment Available now
sa4850 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa17840
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044214 Nonsense 133 334 4 4
Genomic Location (Zv9):
Chromosome 1 (position 31152994)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30966454
GRCz11 1 31699022
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGAATACGAAGAGGTRGTGCATCGTCCTGCTACTCCTCCTCCCCCTTA[C/A]AGCGCCYTAAGCAGYGGCCCTCCAACTTACAGMGGCCCTATAACCACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4850
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044214 Nonsense 151 334 4 4
Genomic Location (Zv9):
Chromosome 1 (position 31153046)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30966506
GRCz11 1 31699074
KASP Assay ID:
554-3519.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGCCYTAAGCAGCGGCCCTCCAACTTACAGCGGCCCTATAACCACAGAC[C/T]AGCAGGATGTCCACTGCCCACCCCAACAGACCACTCCGGTGCCCCCTGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link