mep1a.1
- Ensembl ID:
- ENSDARG00000029747
- ZFIN ID:
- ZDB-GENE-041001-209
- Description:
- meprin A, alpha.1 [Source:RefSeq peptide;Acc:NP_001025452]
- Human Orthologue:
- MEP1A
- Human Description:
- meprin A, alpha (PABA peptide hydrolase) [Source:HGNC Symbol;Acc:7015]
- Mouse Orthologue:
- Mep1a
- Mouse Description:
- meprin 1 alpha Gene [Source:MGI Symbol;Acc:MGI:96963]
Alleles
There are 6 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa17730 |
Nonsense |
Available for shipment |
Available now |
sa13188 |
Essential Splice Site |
Available for shipment |
Available now |
sa10535 |
Essential Splice Site |
Available for shipment |
Available now |
sa6643 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa31046 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa43495 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
Mutation Details
- Allele Name:
- sa17730
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 20 (position 35501573)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
20 |
35574086 |
GRCz11 |
20 |
35476965 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TTTGTCACAGACCTAAACACACCATATGACTAYGAGTCTGTTATGCATTA[T/A]CGTCCATTTGCTTTCAACAAAGACCCCKCTATTCCTACTATTACMACCAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13188
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 20 (position 35503746)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
20 |
35576259 |
GRCz11 |
20 |
35479138 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- AGGTTGAGGATGTCTTCTGCTCGTAGCCTCACCACTGACCTGAGCAAAGG[T/C]ATTTGAGGYCATWACCATGTTTGGGGAAACAATGGGGGAAAATCAACWTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10535
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 20 (position 35503746)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
20 |
35576259 |
GRCz11 |
20 |
35479138 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- AGGTTGAGGATGTCTTCTGCTCGTAGCCTCACCACTGACCTGAGCAAAGG[T/C]ATTTGAGGYCATWACCATGTTTGGGGAAACAATGGGGGAAAATCAACWTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6643
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 20 (position 35505434)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
20 |
35577947 |
GRCz11 |
20 |
35480826 |
- KASP Assay ID:
- 554-5336.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GACCATCAAAGGGATGGAATACTTTCATAAAGCACTACGATTTACACAGA[C/T]GAAATTACCTGAAAAATGATGACCTCATCATCTTTGTTGACTTTGAAGGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31046
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 20 (position 35505442)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
20 |
35577955 |
GRCz11 |
20 |
35480834 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGGGATGGAATACTTTCATAAAGCACTACGATTTACACAGACGAAATTA[C/A]CTGAAAAATGATGACCTCATCATCTTTGTTGACTTTGAAGGTATGCTACA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43495
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 20 (position 35505442)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
20 |
35577955 |
GRCz11 |
20 |
35480834 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGGGATGGAATACTTTCATAAAGCACTACGATTTACACAGACGAAATTA[C/A]CTGAAAAATGATGACCTCATCATCTTTGTTGACTTTGAAGGTATGCTACA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: