zgc:174006

Ensembl ID:
ENSDARG00000029688
ZFIN IDs:
ZDB-GENE-071004-115, ZDB-GENE-071004-115, ZDB-GENE-071004-115, ZDB-GENE-990415-91
Description:
heat shock cognate 70-like [Source:RefSeq peptide;Acc:NP_001120990]
Human Orthologues:
HSPA1A, HSPA1B, HSPA1L, HSPA6
Human Descriptions:
heat shock 70kDa protein 1-like [Source:HGNC Symbol;Acc:5234]
heat shock 70kDa protein 1A [Source:HGNC Symbol;Acc:5232]
heat shock 70kDa protein 1B [Source:HGNC Symbol;Acc:5233]
heat shock 70kDa protein 6 (HSP70B') [Source:HGNC Symbol;Acc:5239]
Mouse Orthologues:
Hspa1a, Hspa1b, Hspa1l
Mouse Descriptions:
heat shock protein 1-like Gene [Source:MGI Symbol;Acc:MGI:96231]
heat shock protein 1A Gene [Source:MGI Symbol;Acc:MGI:96244]
heat shock protein 1B Gene [Source:MGI Symbol;Acc:MGI:99517]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33180 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33180
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045767 Nonsense 43 643 2 2
ENSDART00000109863 Nonsense 43 298 1 3
ENSDART00000124762 Nonsense 43 643 2 2
Genomic Location (Zv9):
Chromosome 3 (position 26920282)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25983954
GRCz10 3 25990783
GRCz11 3 26114825
GRCz11 3 26121654
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGTGGAGATCATCGCCAACGACCAGGGCAACAGAACAACACCCAGCTA[T/A]GTGGCCTTCACAGACACAGAGAGGCTGATTGGAGACGCAGCTAAGAACCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)
  • Ulcerative colitis: Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link