si:dkey-60b12.7

Ensembl ID:
ENSDARG00000029671
ZFIN ID:
ZDB-GENE-060503-266
Description:
Xenotropic and polytropic retrovirus receptor 1 homolog [Source:UniProtKB/Swiss-Prot;Acc:A8DZH4]
Human Orthologue:
XPR1
Human Description:
xenotropic and polytropic retrovirus receptor 1 [Source:HGNC Symbol;Acc:12827]
Mouse Orthologue:
Xpr1
Mouse Description:
xenotropic and polytropic retrovirus receptor 1 Gene [Source:MGI Symbol;Acc:MGI:97932]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39767 Essential Splice Site Mutation detected in F1 DNA During 2018
sa31254 Nonsense Available for shipment Available now
sa6825 Nonsense Mutation detected in F1 DNA During 2018
sa17172 Nonsense Available for shipment Available now
sa19670 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa39767
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050597 Essential Splice Site 75 693 3 15

The following transcripts of ENSDARG00000029671 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 6738085)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 7161655
GRCz11 2 7033261
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCAAACGTGTGAGAAGGAGCTGGCCAAAATCAACACGTTTTATTCTGG[T/A]AAGAAAGTGTAATCATGAGACGTGTTTGAAGCAAAGCTGACGGTTTGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31254
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050597 Nonsense 159 693 5 15

The following transcripts of ENSDARG00000029671 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 6744540)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 7168110
GRCz11 2 7039716
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTCTCTCTTCCATTCAGAATCTAAACTTCACAGGTTTCCGGAAGATTT[T/A]AAAGAAACATGACAAGATCTTTGAGACTTCTCGAGGCGCAGATTGGCGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6825
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050597 Nonsense 445 693 11 15

The following transcripts of ENSDARG00000029671 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 6750846)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 7174416
GRCz11 2 7046022
KASP Assay ID:
554-5468.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCAATGTGTTTTTGTTTACAAATCAGGTGAACGAATTTGTTACTCGTA[T/G]TCATATGGAGTACGAGCTGTAATCAAGTGTTTGCCTGCCTGGTTCCGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17172
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050597 Nonsense 450 693 11 15

The following transcripts of ENSDARG00000029671 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 6750859)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 7174429
GRCz11 2 7046035
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTTACAAATCAGGTGAACGAATTTGTWACTCGTAKTCATATGGAGTA[C/T]GAGCTGTAATCAAGTGTTTGCCTGCCTGGYTCCGGTTTGTGCAATGCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19670
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050597 Essential Splice Site 555 693 12 15

The following transcripts of ENSDARG00000029671 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 6751404)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 7174974
GRCz11 2 7046580
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCAGGGGAAAACACCCTCCTCAGAGAGGAGATCGTATATCCACAGAAA[G/A]TAGGAACACACACATACTCATTTAAATGATTTTGCAGAGAACAATTCACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link