zgc:101132

Ensembl ID:
ENSDARG00000029660
ZFIN ID:
ZDB-GENE-040801-71
Description:
COMM domain-containing protein 5 [Source:RefSeq peptide;Acc:NP_001003553]
Human Orthologue:
COMMD5
Human Description:
COMM domain containing 5 [Source:HGNC Symbol;Acc:17902]
Mouse Orthologue:
Commd5
Mouse Description:
COMM domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:1913648]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35640 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35640
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049482 Essential Splice Site 172 205 6 7
ENSDART00000145118 Essential Splice Site 179 212 6 7
Genomic Location (Zv9):
Chromosome 14 (position 10578237)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 10073594
GRCz11 14 10379608
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTCTCATGCAGATGAAACTGTCAGATGGCCATACACATCAGTTTGAGG[T/C]AATGAATCTTAATTACCGTTTGATTACAATTAGGGATGCTTGATATATCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link