
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tomm70a
- Ensembl ID:
- ENSDARG00000029639
- ZFIN ID:
- ZDB-GENE-030131-8173
- Description:
- mitochondrial import receptor subunit TOM70 [Source:RefSeq peptide;Acc:NP_956296]
- Human Orthologue:
- TOMM70A
- Human Description:
- translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae) [Source:HGNC Symbol;Acc:119
- Mouse Orthologue:
- Tomm70a
- Mouse Description:
- translocase of outer mitochondrial membrane 70 homolog A (yeast) Gene [Source:MGI Symbol;Acc:MGI:106
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa20715 | Essential Splice Site | Available for shipment | Available now |
sa14904 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa20715
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000041998 | Essential Splice Site | 136 | 578 | 2 | 12 |
ENSDART00000147285 | Essential Splice Site | 137 | 579 | 2 | 12 |
- Genomic Location (Zv9):
- Chromosome 6 (position 28671706)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 28967349 GRCz11 6 28957910 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGATCTGTCCACCTTCTACCAGAATAGAGCTGCAGCTTATGAGCAACAGG[T/C]TTGTCTAGGTCATGTGATCATTTGAATCCTCTGTAAAGTGTGTTTGATTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14904
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000041998 | Nonsense | 379 | 578 | 7 | 12 |
ENSDART00000147285 | Nonsense | 380 | 579 | 7 | 12 |
- Genomic Location (Zv9):
- Chromosome 6 (position 28664473)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 28960116 GRCz11 6 28950677 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGGCTGCAGAGATCGATCACCGTAATGCAGATGTSTATCACCACAGAGRA[C/T]AGGTATGACAACTTGTTGTAACTTTAAAGCAAGCATTTGYGGAATGTTTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: