zgc:154039

Ensembl ID:
ENSDARG00000029621
ZFIN ID:
ZDB-GENE-061103-295
Description:
phosphatidylcholine:ceramide cholinephosphotransferase 1 [Source:RefSeq peptide;Acc:NP_001071082]
Human Orthologue:
SGMS1
Human Description:
sphingomyelin synthase 1 [Source:HGNC Symbol;Acc:29799]
Mouse Orthologue:
Sgms1
Mouse Description:
sphingomyelin synthase 1 Gene [Source:MGI Symbol;Acc:MGI:2444110]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12691 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12691
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048526 Essential Splice Site 240 404 3 6
ENSDART00000139054   None 113 None 2
ENSDART00000142418 Essential Splice Site 240 404 3 6
Genomic Location (Zv9):
Chromosome 12 (position 6788654)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 6071574
GRCz11 12 6105158
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTACTACTCTTCCYGTGCCTGGCATGCACTTCAAATGCTCTCCTAAGG[T/A]AAAATARATCTWTCTRTWTTACATMATTTGTTTACTCTTTAAYCCTTTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Response to amphetamines: Genome-wide association study of d-amphetamine response in healthy volunteers identifies putative associations, including cadherin 13 (CDH13). (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link