wdr32

Ensembl ID:
ENSDARG00000029600
ZFIN ID:
ZDB-GENE-040426-2314
Description:
DDB1- and CUL4-associated factor 10 [Source:UniProtKB/Swiss-Prot;Acc:Q6NWH1]
Human Orthologue:
DCAF10
Human Description:
DDB1 and CUL4 associated factor 10 [Source:HGNC Symbol;Acc:23686]
Mouse Orthologue:
Dcaf10
Mouse Description:
DDB1 and CUL4 associated factor 10 Gene [Source:MGI Symbol;Acc:MGI:2140179]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35426 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35426
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047740 Nonsense 109 508 1 7
Genomic Location (Zv9):
Chromosome 13 (position 8925308)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 9227928
GRCz11 13 9559951
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGGGGGCCGTACGTGGACCCCGCGCGGGACCATTTCCGTACCATGACA[C/T]GACTTTATTCGTCCATGAGTCCGGCGGCGGATTCAGTGAACCTCAGCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link