si:dkey-221h15.1

Ensembl ID:
ENSDARG00000029587
ZFIN ID:
ZDB-GENE-041014-344
Description:
peptide methionine sulfoxide reductase [Source:RefSeq peptide;Acc:NP_001076362]
Human Orthologue:
MSRA
Human Description:
methionine sulfoxide reductase A [Source:HGNC Symbol;Acc:7377]
Mouse Orthologue:
Msra
Mouse Description:
methionine sulfoxide reductase A Gene [Source:MGI Symbol;Acc:MGI:106916]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37123 Nonsense Mutation detected in F1 DNA During 2018
sa43505 Nonsense Mutation detected in F1 DNA During 2018
sa18525 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37123
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047362 Nonsense 72 235 3 6
Genomic Location (Zv9):
Chromosome 20 (position 39013848)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 39086260
GRCz11 20 38989139
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGACATTATATCTTGTCTTGTATCTATCTTTTAATTCAGGTATGGGTTG[T/A]TTCTGGGGAGCGGAGAGGAAATTCTGGAGGCAAAAGGGGGTTTATTCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43505
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047362 Nonsense 155 235 5 6
Genomic Location (Zv9):
Chromosome 20 (position 39033008)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 39105420
GRCz11 20 39008299
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTTTTTTTGACAGGAATGCGTCAGGGCAATGATGTCGGGACAACTTA[T/A]CGATCCAGCATCTACACAAACACACAGGAACAGCTGGAGCAGGCTCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18525
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047362 Nonsense 169 235 5 6
Genomic Location (Zv9):
Chromosome 20 (position 39033048)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 39105460
GRCz11 20 39008339
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACAACTTATCGATCCAGCATCTACACAAACACACAGGAACAGCTGGAG[C/T]AGGCTCTGCAGTCCAGGGAAGAGTATCAGAAGGTATTTCATTTTCCCATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Adiposity: Genome-wide association scan meta-analysis identifies three Loci influencing adiposity and fat distribution. (View Study)
  • Alzheimer's disease: Alzheimer disease pathology in cognitively healthy elderly: a genome-wide study. (View Study)
  • Myopia (pathological): A genome-wide association study provides evidence for association of chromosome 8p23 (MYP10) and 10q21.1 (MYP15) with high myopia in the French Population. (View Study)
  • Schizophrenia: A genome-wide association study for quantitative traits in schizophrenia in China. (View Study)
  • Schizophrenia: Genome-wide association study in a Swedish population yields support for greater CNV and MHC involvement in schizophrenia compared with bipolar disorder. (View Study)
  • Systolic blood pressure: Genome-wide association study of blood pressure and hypertension. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link