tbc1d7

Ensembl ID:
ENSDARG00000029581
ZFIN ID:
ZDB-GENE-040426-1747
Description:
TBC1 domain family member 7 [Source:RefSeq peptide;Acc:NP_957071]
Human Orthologue:
TBC1D7
Human Description:
TBC1 domain family, member 7 [Source:HGNC Symbol;Acc:21066]
Mouse Orthologue:
Tbc1d7
Mouse Description:
TBC1 domain family, member 7 Gene [Source:MGI Symbol;Acc:MGI:1914296]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45719 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45719
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040265 Essential Splice Site None 294 2 9
Genomic Location (Zv9):
Chromosome 20 (position 53182614)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 53035347
GRCz11 20 52840953
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTAAATCCTGATGTAATGTAGTAATCTGTGCTTGTGCTGTGGTGTTTCA[G/A]TCTCCTGTCAGTGATCATGGCTGATGATCCTCAGAGAAACTTCCGCTCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link