zgc:123261

Ensembl ID:
ENSDARG00000029511
ZFIN ID:
ZDB-GENE-051120-78
Description:
hypothetical protein LOC558674 [Source:RefSeq peptide;Acc:NP_001032460]
Human Orthologue:
KCNS3
Human Description:
potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3 [Source:HGNC Symbol;Acc:63
Mouse Orthologue:
Kcns3
Mouse Description:
potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3 Gene [Source:MGI Symbol;Ac

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23653 Nonsense Available for shipment Available now
sa1703 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23653
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044937 Nonsense 101 424 2 2
ENSDART00000137715 Nonsense 101 416 1 1
Genomic Location (Zv9):
Chromosome 20 (position 14031911)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 14221157
GRCz11 20 14117137
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACTGGACACTTCCACACTCTGGAGGAACTGTGCGTGTTCTGCTTCAGC[C/T]AGGAGATCGAATACTGGGGTCTCTGTGAACTGGATCTAGACGCCTGTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1703
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044937 Nonsense 175 424 2 2
ENSDART00000137715 Nonsense 175 416 1 1
Genomic Location (Zv9):
Chromosome 20 (position 14032133)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 14221379
GRCz11 20 14117359
KASP Assay ID:
554-1649.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCGGTGCTCAGATGTTCGAAAGCTGATGTGGGAAACTCTTGAAGATCCT[C/T]AACACTCCAGATGTTCCCGAGGTGTGGCTGCGGTTTCTGTCCTAGTGATT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link