zgc:86609

Ensembl ID:
ENSDARG00000029479
ZFIN ID:
ZDB-GENE-050102-7
Description:
hypothetical protein LOC494496 [Source:RefSeq peptide;Acc:NP_001009987]
Human Orthologue:
TMEM111
Human Description:
transmembrane protein 111 [Source:HGNC Symbol;Acc:23999]
Mouse Orthologue:
Tmem111
Mouse Description:
transmembrane protein 111 Gene [Source:MGI Symbol;Acc:MGI:1913337]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38669 Essential Splice Site Mutation detected in F1 DNA During 2018
sa38668 Nonsense Mutation detected in F1 DNA During 2018
sa34301 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38669
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046712 Essential Splice Site 52 253 1 8
Genomic Location (Zv9):
Chromosome 8 (position 9243118)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8659700
GRCz11 8 8698285
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTCATCCATAATGAGAAGAAAGTGGATCTGCAGCAGGTGTCTGACAGG[T/G]GAGAATCAAAAATACAGGTGTTTAGATATAAACAGATACATTAAACAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38668
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046712 Nonsense 65 253 2 8
Genomic Location (Zv9):
Chromosome 8 (position 9240972)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8657554
GRCz11 8 8696139
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCACTTTACAGCCAGGTTTTGCTGCGCAGTCGCATATTAAGAGAAAAC[G/T]GAAAGTATCTTCCTAAACAGGTTTTGATTATTGTATTATATTATGAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34301
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046712 Nonsense 171 253 6 8
Genomic Location (Zv9):
Chromosome 8 (position 9238512)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8655094
GRCz11 8 8693679
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAACCCAGAATAAACTCTGTTCCTCTTACAGGGTTAGTTCAGCTTCAT[G/A]GTATTTTCTTAATGTGTTCGGGCTCAGAAGCATGTACACCCTCATCCTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link