zgc:110426

Ensembl ID:
ENSDARG00000029452
ZFIN ID:
ZDB-GENE-050522-102
Description:
hypothetical protein LOC553620 [Source:RefSeq peptide;Acc:NP_001018430]
Human Orthologue:
NEURL1B
Human Description:
neuralized homolog 1B (Drosophila) [Source:HGNC Symbol;Acc:35422]
Mouse Orthologue:
Neurl1B
Mouse Description:
neuralized homolog 1B (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:3643092]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31979 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31979
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066101 Nonsense 211 560 3 5
ENSDART00000106460   None 175 None 5
Genomic Location (Zv9):
Chromosome 14 (position 19578419)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 15372872
GRCz11 14 15678435
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTTTCCTCTTTTAGAGAGCACATTTGCTGAGAGCGTTGGTGCGAGCTG[T/A]CTGAGTACCGCCCGACTCAGTGCCTATCTGCCCCAGAGCAACCACGACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link