
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:63614
- Ensembl ID:
- ENSDARG00000029446
- ZFIN ID:
- ZDB-GENE-040426-1191
- Description:
- beta,beta-carotene 15,15'-monooxygenase [Source:RefSeq peptide;Acc:NP_956902]
- Human Orthologue:
- BCMO1
- Human Description:
- beta-carotene 15,15'-monooxygenase 1 [Source:HGNC Symbol;Acc:13815]
- Mouse Orthologue:
- Bcmo1
- Mouse Description:
- beta-carotene 15,15'-monooxygenase Gene [Source:MGI Symbol;Acc:MGI:1926923]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa24745 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa24745
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000046776 | Nonsense | 331 | 525 | 7 | 11 |
- Genomic Location (Zv9):
- Chromosome Zv9_scaffold3485 (position 39140)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 65023333 GRCz11 7 65247361 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GATGGCCACGTCGTCTTTGATCTGATTACATACAAGGACAGTAAGCTGTA[T/A]GATATGTTCTACATACAAAACATGAAGCAAGACGTCAAAAGGTTTATAGA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Carotenoid and tocopherol levels: Common variation in the beta-carotene 15,15'-monooxygenase 1 gene affects circulating levels of carotenoids: a genome-wide association study. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: