zgc:63614

Ensembl ID:
ENSDARG00000029446
ZFIN ID:
ZDB-GENE-040426-1191
Description:
beta,beta-carotene 15,15'-monooxygenase [Source:RefSeq peptide;Acc:NP_956902]
Human Orthologue:
BCMO1
Human Description:
beta-carotene 15,15'-monooxygenase 1 [Source:HGNC Symbol;Acc:13815]
Mouse Orthologue:
Bcmo1
Mouse Description:
beta-carotene 15,15'-monooxygenase Gene [Source:MGI Symbol;Acc:MGI:1926923]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24745 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24745
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046776 Nonsense 331 525 7 11
Genomic Location (Zv9):
Chromosome Zv9_scaffold3485 (position 39140)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 65023333
GRCz11 7 65247361
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGGCCACGTCGTCTTTGATCTGATTACATACAAGGACAGTAAGCTGTA[T/A]GATATGTTCTACATACAAAACATGAAGCAAGACGTCAAAAGGTTTATAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link