zgc:73237

Ensembl ID:
ENSDARG00000029419
ZFIN ID:
ZDB-GENE-030131-2784
Description:
hematological and neurological expressed 1 [Source:RefSeq peptide;Acc:NP_991176]
Human Orthologue:
HN1
Human Description:
hematological and neurological expressed 1 [Source:HGNC Symbol;Acc:14569]
Mouse Orthologue:
Hn1
Mouse Description:
hematological and neurological expressed sequence 1 Gene [Source:MGI Symbol;Acc:MGI:1096361]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31311 Essential Splice Site Available for shipment Available now
sa14879 Nonsense Available for shipment Available now
sa10551 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31311
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042594 Essential Splice Site 66 150 2 5
Genomic Location (Zv9):
Chromosome 3 (position 6977988)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 6523140
GRCz11 3 6409258
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGCTGAACCCGACGACCCTCACGCCCACCGGAGGAACAACCCGCCAGG[T/C]ACACACAAATACACACACACACACACACACAAATACACGCGCACGCACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14879
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042594 Nonsense 83 150 3 5
Genomic Location (Zv9):
Chromosome 3 (position 6993067)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 6508061
GRCz11 3 6394179
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGAGAAGCGTCTGGAGTGTTGTGCGGTGAACCYTCAGCTCCTCTGAGA[C/T]GATGTCAGCCTGCTATAGTGTATGATGAAGGTGCAGGAGAGCCACAGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10551
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042594 Essential Splice Site 113 150 4 5
Genomic Location (Zv9):
Chromosome 3 (position 6998754)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 6502374
GRCz11 3 6388492
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TWGTTTTTTGTTTTGCAGGATCATCATGAATATGAGCAAGAGAACCACGG[T/C]GAGTCTGACTTTCCTCCTGTAGGTAGGTNNNNGTGCGTGCGTGCGTGYGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link