
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:103715
- Ensembl ID:
- ENSDARG00000029381
- ZFIN ID:
- ZDB-GENE-040912-103
- Description:
- hypothetical protein LOC447920 [Source:RefSeq peptide;Acc:NP_001004658]
- Human Orthologues:
- ALDH3A1, ALDH3A2
- Human Descriptions:
- aldehyde dehydrogenase 3 family, member A1 [Source:HGNC Symbol;Acc:405]
- aldehyde dehydrogenase 3 family, member A2 [Source:HGNC Symbol;Acc:403]
- Mouse Orthologues:
- Aldh3a1, Aldh3a2
- Mouse Descriptions:
- aldehyde dehydrogenase family 3, subfamily A1 Gene [Source:MGI Symbol;Acc:MGI:1353451]
- aldehyde dehydrogenase family 3, subfamily A2 Gene [Source:MGI Symbol;Acc:MGI:1353452]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa11734 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa11734
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000049453 | None | 169 | None | 4 | |
ENSDART00000114885 | Essential Splice Site | 230 | 407 | 6 | 11 |
- Genomic Location (Zv9):
- Chromosome 21 (position 37877140)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 38997325 GRCz11 21 39042277 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTTKAATGCAAGTCTCTGAAAKGATTTCAAACATGTGTGATCTGTGAACC[A/G]GGCGGATTGCRTGGGGAAAATACTCAAACTGTGGACAGACCTGCATCGCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: