zgc:103715

Ensembl ID:
ENSDARG00000029381
ZFIN ID:
ZDB-GENE-040912-103
Description:
hypothetical protein LOC447920 [Source:RefSeq peptide;Acc:NP_001004658]
Human Orthologues:
ALDH3A1, ALDH3A2
Human Descriptions:
aldehyde dehydrogenase 3 family, member A1 [Source:HGNC Symbol;Acc:405]
aldehyde dehydrogenase 3 family, member A2 [Source:HGNC Symbol;Acc:403]
Mouse Orthologues:
Aldh3a1, Aldh3a2
Mouse Descriptions:
aldehyde dehydrogenase family 3, subfamily A1 Gene [Source:MGI Symbol;Acc:MGI:1353451]
aldehyde dehydrogenase family 3, subfamily A2 Gene [Source:MGI Symbol;Acc:MGI:1353452]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11734 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11734
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049453   None 169 None 4
ENSDART00000114885 Essential Splice Site 230 407 6 11
Genomic Location (Zv9):
Chromosome 21 (position 37877140)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 38997325
GRCz11 21 39042277
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTKAATGCAAGTCTCTGAAAKGATTTCAAACATGTGTGATCTGTGAACC[A/G]GGCGGATTGCRTGGGGAAAATACTCAAACTGTGGACAGACCTGCATCGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link