si:dkey-93f15.3

Ensembl ID:
ENSDARG00000029372
ZFIN ID:
ZDB-GENE-060526-349
Description:
ras GTPase-activating protein 4 [Source:RefSeq peptide;Acc:NP_001092921]
Human Orthologues:
RASA4, RASA4B
Human Descriptions:
RAS p21 protein activator 4 [Source:HGNC Symbol;Acc:23181]
RAS p21 protein activator 4B [Source:HGNC Symbol;Acc:35202]
Mouse Orthologue:
Rasa4
Mouse Description:
RAS p21 protein activator 4 Gene [Source:MGI Symbol;Acc:MGI:1858600]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5749 Essential Splice Site F2 line generated During 2018
sa2226 Essential Splice Site F2 line generated During 2018
sa18002 Essential Splice Site Available for shipment Available now
sa33731 Nonsense Mutation detected in F1 DNA During 2018
sa18178 Nonsense Available for shipment Available now
sa33732 Essential Splice Site Mutation detected in F1 DNA During 2018
sa11873 Nonsense Available for shipment Available now
sa33733 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa5749
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097374 Essential Splice Site 22 800 1 21
ENSDART00000097374 Essential Splice Site 22 800 1 21
Genomic Location (Zv9):
Chromosome 5 (position 60976822)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 58608949
GRCz11 5 59278658
KASP Assay ID:
554-2897.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCTATTCATCAGGATTGTGGAAGGAAAGAACCTGCCAATCAAGGATAT[G/A]TAAGTGTTGATGACTTTATGGGATTATTTGAAGTTAAATTATTTAGAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2226
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097374 Essential Splice Site 22 800 1 21
ENSDART00000097374 Essential Splice Site 22 800 1 21
Genomic Location (Zv9):
Chromosome 5 (position 60976822)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 58608949
GRCz11 5 59278658
KASP Assay ID:
554-2897.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCTATTCATCAGGATTGTGGAAGGAAAGAACCTGCCAATCAAGGATAT[G/A]TAAGTGTTGATGACTTTATGGGATTATTTGAAGTTAAATTATTTAGAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18002
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097374 Essential Splice Site 22 800 1 21
Genomic Location (Zv9):
Chromosome 5 (position 60976823)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 58608950
GRCz11 5 59278659
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTATTCATCAGGATTGTGGAAGGAAAGAACCTGCCAATCAAGGATATR[T/A]AAGTGTTKATGACTTTATGGGATTATTTGAAGTTAAATTATTTAGAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33731
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097374 Nonsense 117 800 5 21
Genomic Location (Zv9):
Chromosome 5 (position 61024481)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 58656608
GRCz11 5 59326317
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTGACGGATGGATGAACCTAACAGAGATTGACCCAGATGAGGAGGTG[C/T]AAGGGGAGATTCACCTCCAGATCTCAGTGCTGGGAGATGGAGATATCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18178
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097374 Nonsense 210 800 7 21
Genomic Location (Zv9):
Chromosome 5 (position 61026895)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 58659022
GRCz11 5 59328731
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACTGACAGTCTACTGAGTGTGGAGGTGTGGGACTGGGATCTGRTCAGC[A/T]GAAATGACTTCCTGGGAAAGGTGAAGTACATTTCCTGCATGGAGCAYTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33732
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097374 Essential Splice Site 247 800 8 21
Genomic Location (Zv9):
Chromosome 5 (position 61039901)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 58672028
GRCz11 5 59341737
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGCTGGTTCCGCCTGGGGCCTGACAAATCTAAACACAGCGAATATGAG[T/A]GAGTCTATTTGAAAAATAAAGCGGAGAGCAAATTAAAGAACAGATAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11873
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097374 Nonsense 556 800 16 21
Genomic Location (Zv9):
Chromosome 5 (position 61076441)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 58708568
GRCz11 5 59378277
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTTWCTTGTGTTTACTTTATTTTGAATCCAGATCTTGAACTTCAGACA[C/T]GAATGAGCCTCCAGTGCGGCACTATGGAGAAAGAGGGTTTTCTCTTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33733
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097374 Essential Splice Site 699 800 18 21
Genomic Location (Zv9):
Chromosome 5 (position 61079060)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 58711187
GRCz11 5 59380896
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTACAAAGCAGACAGATGGAGCTGCTGCCATCAGAAGGAGAAATCAGG[T/C]ACTGCAAAATATTACACTGTGTTTTAGCTAGTATTGAGCTAATGTTTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link