zgc:101798

Ensembl ID:
ENSDARG00000029356
ZFIN ID:
ZDB-GENE-041114-98
Description:
lysophospholipid acyltransferase 1 [Source:RefSeq peptide;Acc:NP_001007397]
Human Orthologue:
MBOAT1
Human Description:
membrane bound O-acyltransferase domain containing 1 [Source:HGNC Symbol;Acc:21579]
Mouse Orthologue:
Mboat1
Mouse Description:
membrane bound O-acyltransferase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2387184]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32071 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32071
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019813 Nonsense 385 391 11 11
ENSDART00000050249   None 496 None 13
ENSDART00000141860   382 383 11 11
ENSDART00000148042   None 484 13 13
Genomic Location (Zv9):
Chromosome 16 (position 7609471)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 6455203
GRCz11 16 6395881
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTTTATGCGTGTGTGTGTGTGTGTGCGCGCGGGGTCGCCTTTGTGC[A/T]AACTGAGAGAGCAACGACATTGACGGACAAAGGCTACTTTGTGTGAACAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link