zgc:163073

Ensembl ID:
ENSDARG00000029321
ZFIN ID:
ZDB-GENE-070410-135
Description:
myosin light chain 6B [Source:RefSeq peptide;Acc:NP_001082980]
Human Orthologue:
MYL3
Human Description:
myosin, light chain 3, alkali; ventricular, skeletal, slow [Source:HGNC Symbol;Acc:7584]
Mouse Orthologue:
Myl3
Mouse Description:
myosin, light polypeptide 3 Gene [Source:MGI Symbol;Acc:MGI:97268]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41954 Nonsense Mutation detected in F1 DNA During 2018
sa27872 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41954
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066501 Nonsense 6 213 1 7
Genomic Location (Zv9):
Chromosome 12 (position 6017040)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4805998
GRCz11 12 4840955
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAATATTGTCAGCCTGATTTGTGATCACACCATTATGGCTTCACCAAAA[C/T]AAGCACCCAAAAAAGAAGATCTAAAGGAAGATCCAGCTCCAGGAGCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27872
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066501 Nonsense 203 213 5 7
Genomic Location (Zv9):
Chromosome 12 (position 6019923)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4803115
GRCz11 12 4838072
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGATCAGTTGCTGGCAGGGCAGGAGGACACAAATGGTTGTATTAACTA[T/A]GAAGGTAAGAACACCTCAAGACTTTACTGATAAAAATATTTACTATTAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link