
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:101800
- Ensembl ID:
- ENSDARG00000029307
- ZFIN ID:
- ZDB-GENE-041212-46
- Description:
- colon cancer-associated protein Mic1 [Source:RefSeq peptide;Acc:NP_001008621]
- Human Orthologue:
- C18orf8
- Human Description:
- chromosome 18 open reading frame 8 [Source:HGNC Symbol;Acc:24326]
- Mouse Orthologue:
- 3110002H16Rik
- Mouse Description:
- RIKEN cDNA 3110002H16 gene Gene [Source:MGI Symbol;Acc:MGI:1916528]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa9682 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa9682
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000050826 | Essential Splice Site | 398 | 657 | 13 | 20 |
- Genomic Location (Zv9):
- Chromosome 24 (position 34705560)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 33557100 GRCz11 24 33471414 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTGCGCAGACGAGACTGCAAAATGGTCATCTTGTCTGTATGCTCGCAAAG[T/C]AAGTTATTTTTCCCATATTTTATCTAGATATTTATCCATATMATTTATTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: