zgc:158331

Ensembl ID:
ENSDARG00000029291
ZFIN ID:
ZDB-GENE-061215-5
Description:
inositol polyphosphate multikinase [Source:RefSeq peptide;Acc:NP_001073533]
Human Orthologue:
IPMK
Human Description:
inositol polyphosphate multikinase [Source:HGNC Symbol;Acc:20739]
Mouse Orthologue:
Ipmk
Mouse Description:
inositol polyphosphate multikinase Gene [Source:MGI Symbol;Acc:MGI:1916968]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27886 Missense Mutation detected in F1 DNA During 2018
sa5850 Nonsense Mutation detected in F1 DNA During 2018
sa6234 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa27886
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048866 Missense 54 372 1 6
Genomic Location (Zv9):
Chromosome 12 (position 7906506)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 7201092
GRCz11 12 7234595
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGTGCCGCTCTCTCACCAGGTGGCCGGACACAAGTATGGCGTTGATAAA[G/A]TGGGTCAGTACACCTTTCATGTCATTCATTTTCATTCTGTTATTCAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5850
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048866 Nonsense 273 372 6 6
Genomic Location (Zv9):
Chromosome 12 (position 7871459)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 7166045
GRCz11 12 7199548
KASP Assay ID:
554-3698.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGGATCCCAGAGCCTTCCGGAAAGCCYGATCAAACCTGAGAYCTGCGAG[C/T]AGAACAACAACATCTCCACCATGTACTCCCTGCACAAGAAAAGCTGCGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6234
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048866 Nonsense 297 372 6 6
Genomic Location (Zv9):
Chromosome 12 (position 7871387)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 7165973
GRCz11 12 7199476
KASP Assay ID:
554-4315.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTACTCCCTGCACAAGAAAAGCTGCGTCCGGAGCCACTACCAAACCAAT[C/T]AGGACAACGGCGTCTGGAGCTCCTCGCARCAGCCCAACGGAAACTGCAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link