ssb

Ensembl ID:
ENSDARG00000029252
ZFIN ID:
ZDB-GENE-030131-223
Description:
Sjogren syndrome antigen B (autoantigen La) [Source:RefSeq peptide;Acc:NP_955841]
Human Orthologue:
SSB
Human Description:
Sjogren syndrome antigen B (autoantigen La) [Source:HGNC Symbol;Acc:11316]
Mouse Orthologue:
Ssb
Mouse Description:
Sjogren syndrome antigen B Gene [Source:MGI Symbol;Acc:MGI:98423]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20611 Nonsense Available for shipment Available now
sa13516 Nonsense Available for shipment Available now
sa20612 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20611
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041627 Nonsense 127 401 5 12
Genomic Location (Zv9):
Chromosome 6 (position 3532731)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 3560226
GRCz11 6 3721046
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACAGAAAGGCTTTCCTCTTGAAACTACGCTGGATGATGTTAAAGAGTG[G/A]CTTGCTGATAAAGGCACATTTGAAAACATCTACCTGAGGAAAGGACCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13516
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041627 Nonsense 196 401 7 12
Genomic Location (Zv9):
Chromosome 6 (position 3534853)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 3562348
GRCz11 6 3723168
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCTGYCCATAGAGATGCCTACTTTACTAAAAAGATAGCYGAGAGGAAG[C/T]AGAACCGTGTGGAATCTAAAGCTAAAGCCAAATGGTAAAGCACAACACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20612
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041627 Nonsense 357 401 11 12
Genomic Location (Zv9):
Chromosome 6 (position 3537473)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 3564968
GRCz11 6 3725788
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGAGGAGGCCGCAGAGACCGAGGAGGACGAGAACACACTCAGTTCAAG[G/T]GAAAGAAGACCAAGTTTGATAGCGATGAAGAGGGAGATGAAGGTAAAAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link