zgc:110185

Ensembl ID:
ENSDARG00000029250
ZFIN ID:
ZDB-GENE-050417-376
Description:
DNA polymerase iota [Source:RefSeq peptide;Acc:NP_001017834]
Human Orthologue:
POLI
Human Description:
polymerase (DNA directed) iota [Source:HGNC Symbol;Acc:9182]
Mouse Orthologue:
Poli
Mouse Description:
polymerase (DNA directed), iota Gene [Source:MGI Symbol;Acc:MGI:1347081]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30858 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30858
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041371 Essential Splice Site 245 710 5 10
Genomic Location (Zv9):
Chromosome 5 (position 20704115)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 18416574
GRCz11 5 18920366
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCACCGCTGAACTCATGAGCAGCCTTACAGGACTCATCAAAGTGCCAG[G/A]TAACATCACACAGAAACTCACCCATTCAGTGGCTACCTATCAATGCTAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link