
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
fbxo3
- Ensembl ID:
- ENSDARG00000029242
- ZFIN ID:
- ZDB-GENE-050522-269
- Description:
- F-box only protein 3 [Source:RefSeq peptide;Acc:NP_001018538]
- Human Orthologue:
- FBXO3
- Human Description:
- F-box protein 3 [Source:HGNC Symbol;Acc:13582]
- Mouse Orthologue:
- Fbxo3
- Mouse Description:
- F-box protein 3 Gene [Source:MGI Symbol;Acc:MGI:1929084]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa21023 | Essential Splice Site | Available for shipment | Available now |
sa38630 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa21023
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000139382 | Essential Splice Site | 31 | 451 | None | 11 |
The following transcripts of ENSDARG00000029242 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 7 (position 40106553)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 38443193 GRCz11 7 38714451 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATCCCTTACTTCTGGTGCTGTCATTCCTGGACTTCCGAGATCTTATCAGG[T/C]AGACATTACACTCGAGCCATACCGTTAGTCCGTGCAACAGCAAGCACGAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38630
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000139382 | Nonsense | 394 | 451 | 10 | 11 |
The following transcripts of ENSDARG00000029242 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 7 (position 40097396)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 38434036 GRCz11 7 38705294 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CATTCCACCGGCTCAAGAACAAAGAGGAAGTGTTTGACGTTTCCATCCCA[C/T]GATTCCACATGGTGTGCCCACCATTCCGCGAGTCAGTGGTGCGCTCCGTA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: