stxbp5b

Ensembl ID:
ENSDARG00000029234
ZFIN ID:
ZDB-GENE-090821-5
Human Orthologue:
STXBP5
Human Description:
syntaxin binding protein 5 (tomosyn) [Source:HGNC Symbol;Acc:19665]
Mouse Orthologue:
Stxbp5
Mouse Description:
syntaxin binding protein 5 (tomosyn) Gene [Source:MGI Symbol;Acc:MGI:1926058]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39146 Nonsense Mutation detected in F1 DNA During 2018
sa42867 Nonsense Mutation detected in F1 DNA During 2018
sa36311 Nonsense Mutation detected in F1 DNA During 2018
sa22995 Nonsense Available for shipment Available now
sa12880 Nonsense Available for shipment Available now
sa39145 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39146
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098731 Nonsense 220 1158 6 28
Genomic Location (Zv9):
Chromosome 17 (position 7138846)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7143112
GRCz11 17 7300342
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAGACTCACCCTGGACCAGTAGTTCACATCAGCGATAACCCCATGGAT[G/T]AAGGAAAAGTAAGTTTGAACTACAGTTAAGATTATATGTTTCCCTACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42867
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098731 Nonsense 471 1158 14 28
Genomic Location (Zv9):
Chromosome 17 (position 7120505)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7124771
GRCz11 17 7282001
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATATTACTCTCTTTTTGTTTTCTTCCTGAAACAGGCATGCTGATGGAT[C/A]GATCAAGTTTTGGGATGCCTCAGCTTGTGAGTTTCTTTCTAAAACAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36311
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098731 Nonsense 583 1158 16 28
Genomic Location (Zv9):
Chromosome 17 (position 7114408)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7118674
GRCz11 17 7275904
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAATCTCCAGAGGGTGGAGGAGACCAGGCGTCGGCTGTTTCCACCCCA[G/T]GAACTGCACCCAGCCCTCAGACCAGCCTGCCTCAGTCTCACCCCTCCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22995
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098731 Nonsense 743 1158 20 28
Genomic Location (Zv9):
Chromosome 17 (position 7101366)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7105632
GRCz11 17 7262862
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTGCTGTAGGCTCCGGTTCACCGTGCAATTCTGATGAAGACAGCAAA[C/T]AAAAGTTCATTGAGAGGGGTACAGTACATACAGCATACAAAAAATACCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12880
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098731 Nonsense 1004 1158 25 28
Genomic Location (Zv9):
Chromosome 17 (position 7082849)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7087115
GRCz11 17 7244345
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGTGAACTACCTTCCTCTGACGGACATGAGGATAGCCAGAAYCTTCTG[T/A]TTCTCAAACCAAGGCCAAGCCCTRTACCTCACATCGCCCACTGAGATCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39145
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098731 Essential Splice Site 1146 1158 28 28
Genomic Location (Zv9):
Chromosome 17 (position 7071347)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7075613
GRCz11 17 7232843
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGCCAATTTATTGTTGTTTTCATGAACAATTCCTGTTTGTCTTCTCCA[G/A]ATGATGCTGAAATACAAGGACAAGAAATGGTACCAGCTCTGAGGGCCTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Coagulation factor levels: Novel associations of multiple genetic loci with plasma levels of factor VII, factor VIII, and von Willebrand factor: The CHARGE (Cohorts for Heart and Aging Research in Genome Epidemiology) Consortium. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link