zgc:92419

Ensembl ID:
ENSDARG00000029215
ZFIN ID:
ZDB-GENE-040718-15
Description:
Ubiquitin-conjugating enzyme E2 Z [Source:UniProtKB/Swiss-Prot;Acc:Q6DG60]
Human Orthologue:
UBE2Z
Human Description:
ubiquitin-conjugating enzyme E2Z [Source:HGNC Symbol;Acc:25847]
Mouse Orthologue:
Ube2z
Mouse Description:
ubiquitin-conjugating enzyme E2Z (putative) Gene [Source:MGI Symbol;Acc:MGI:1343160]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19996 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19996
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124921 Essential Splice Site 130 380 1 8
Genomic Location (Zv9):
Chromosome 3 (position 23887384)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 23465595
GRCz11 3 23596143
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTGGGACAACGAAAAGGCGTCTCAGCAGTGTATTCTCCGAATAAAAAG[G/A]TAACGATAGACTGTCTTGAAGTGTCAGAGTTTGTTTAGGGAAATTTAAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link