
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
hsp90ab1
- Ensembl ID:
- ENSDARG00000029150
- ZFIN ID:
- ZDB-GENE-990415-95
- Description:
- Heat shock protein HSP 90-beta [Source:UniProtKB/Swiss-Prot;Acc:O57521]
- Human Orthologues:
- HSP90AB1, HSP90AB4P
- Human Descriptions:
- heat shock protein 90kDa alpha (cytosolic), class B member 1 [Source:HGNC Symbol;Acc:5258]
- heat shock protein 90kDa alpha (cytosolic), class B member 4 (pseudogene) [Source:HGNC Symbol;Acc:32
- Mouse Orthologue:
- Hsp90ab1
- Mouse Description:
- heat shock protein 90 alpha (cytosolic), class B member 1 Gene [Source:MGI Symbol;Acc:MGI:96247]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa12875 | Essential Splice Site | Available for shipment | Available now |
sa10 | Essential Splice Site | Confirmed mutation in F2 line | During 2018 |
sa15412 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa12875
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000020084 | Essential Splice Site | 49 | 725 | None | 12 |
ENSDART00000129014 | Essential Splice Site | 49 | 710 | None | 12 |
The following transcripts of ENSDARG00000029150 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 20 (position 51534611)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 51386680 GRCz11 20 51199900 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAAKGRTTAATTGATRCATCDGCAAAATRTTCCCATTKCTCNNTTTTAAT[A/T]GGCTCTTGACAAAATCAGATATGAAAGYTTGACAGATCCCACCAAACTGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10
- Current Status:
-
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000020084 | Essential Splice Site | 318 | 725 | 6 | 12 |
ENSDART00000129014 | Essential Splice Site | 303 | 710 | 6 | 12 |
The following transcripts of ENSDARG00000029150 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 20 (position 51537521)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 51389590 GRCz11 20 51202810 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTTTTACAAGAGCCTGACCAACGACTGGGAAGACCACCTGGCTGTCAAGG[T/C]AATAGGAGCTCTACTAAGTGGGATGTAATGTATTAGGGATGTAATGAACT
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa15412
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000020084 | Nonsense | 471 | 725 | 9 | 12 |
ENSDART00000129014 | Nonsense | 456 | 710 | 9 | 12 |
The following transcripts of ENSDARG00000029150 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 20 (position 51540752)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 51392821 GRCz11 20 51206041 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CGTTACCAGAGCTCRCAGTCCGGCGACGAGATGASCTCCCTCACAGAATA[C/A]GTCAGCCGTATGAAGGAGAACCAAAAGTCCATCTATTACATCACTGGTAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: