prpf31

Ensembl ID:
ENSDARG00000029114
ZFIN ID:
ZDB-GENE-040426-1561
Description:
U4/U6 small nuclear ribonucleoprotein Prp31 [Source:UniProtKB/Swiss-Prot;Acc:Q7SXM7]
Human Orthologue:
PRPF31
Human Description:
PRP31 pre-mRNA processing factor 31 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:15446]
Mouse Orthologue:
Prpf31
Mouse Description:
PRP31 pre-mRNA processing factor 31 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1916238]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42764 Nonsense Mutation detected in F1 DNA During 2018
sa15636 Nonsense Available for shipment Available now
sa36189 Nonsense Mutation detected in F1 DNA During 2018
sa11927 Nonsense Available for shipment Available now
sa22886 Essential Splice Site Available for shipment Available now
sa5624 Nonsense F2 line generated During 2018
sa2865 Nonsense F2 line generated During 2018
sa25022 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42764
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039845 Nonsense 175 3209 5 27
ENSDART00000137029   None 508 None 14
ENSDART00000140794   None 240 None 6

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 34378732)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32110232
GRCz11 16 32064262
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTATCAGGCAGTGGTGAAGGAGCTGAGGGTCAGTGCTAGTCCTCTGGAA[C/T]AGCGGAAGTTCCTGGCAGAGTCCGAGCCATACAGGTCAGACAAACTGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15636
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039845 Nonsense 297 3209 9 27
ENSDART00000137029   None 508 None 14
ENSDART00000140794   None 240 None 6
Genomic Location (Zv9):
Chromosome 16 (position 34381998)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32113498
GRCz11 16 32067528
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTAATTTGCANNNNNNNNNNTTTTCATTTTCATATTTTACACAAACAGGAGGATTATTA[T/A]CTAACCCCAGACAAATTGTGGATACCTCTCCGCTGGATTGCTCCTGAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36189
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039845 Nonsense 835 3209 11 27
ENSDART00000137029   None 508 None 14
ENSDART00000140794   None 240 None 6
Genomic Location (Zv9):
Chromosome 16 (position 34383990)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32115490
GRCz11 16 32069520
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGATGCTAGAAATGCTGACAGAGGCATGACACGATCTCAGTCTTTGTA[T/A]AATTCTAGAGATGCTCCAACTTCACACATTACAGATGATGAATTCTCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11927
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039845 Nonsense 2697 3209 14 27
ENSDART00000137029   None 508 None 14
ENSDART00000140794   None 240 None 6

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 34392095)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32123595
GRCz11 16 32077625
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCGTRACCGTGGGAGGAATGTGTCATTTTTCGATGACGTCACAGTCTA[T/A]MTTTTCGATCAGGTATGTCAAGGGTGTTTATACAAGCATCTTCAATTACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22886
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039845 Essential Splice Site 2852 3209 18 27
ENSDART00000137029 Essential Splice Site 151 508 5 14
ENSDART00000140794 Essential Splice Site 151 240 4 6
Genomic Location (Zv9):
Chromosome 16 (position 34399528)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32131028
GRCz11 16 32085058
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGGAGTCTCTGGTGCCAAATGCACTGGACTACATCAGAACTGTTAAGG[T/A]ATGTAGAAACCTGCCTGTCTGTAATTTAGCTTTTATGAGCAGACTATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5624
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039845 Nonsense 3062 3209 23 27
ENSDART00000137029 Nonsense 361 508 10 14
ENSDART00000140794   None 240 None 6
ENSDART00000039845 Nonsense 3062 3209 23 27
ENSDART00000137029 Nonsense 361 508 10 14
ENSDART00000140794   None 240 None 6
Genomic Location (Zv9):
Chromosome 16 (position 34401559)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32133059
GRCz11 16 32087089
KASP Assay ID:
554-3102.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCTCCACCAGTCAAGCAGGTCAAGCCTCTTCCAGCTCCTCTGGATGGA[C/T]AGAGGAAGAAGAGAGGAGGAAGAAGGTGAGGGTGGGAATGTTGTGGTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2865
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039845 Nonsense 3062 3209 23 27
ENSDART00000137029 Nonsense 361 508 10 14
ENSDART00000140794   None 240 None 6
ENSDART00000039845 Nonsense 3062 3209 23 27
ENSDART00000137029 Nonsense 361 508 10 14
ENSDART00000140794   None 240 None 6
Genomic Location (Zv9):
Chromosome 16 (position 34401559)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32133059
GRCz11 16 32087089
KASP Assay ID:
554-3102.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCTCCACCAGTCAAGCAGGTCAAGCCTCTTCCAGCTCCTCTGGATGGA[C/T]AGAGGAAGAAGAGAGGAGGAAGAAGGTGAGGGTGGGAATGTTGTGGTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25022
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039845 Nonsense 3191 3209 27 27
ENSDART00000137029 Nonsense 490 508 14 14
ENSDART00000140794   None 240 None 6
Genomic Location (Zv9):
Chromosome 16 (position 34404816)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32136316
GRCz11 16 32090346
KASP Assay ID:
554-7649.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAACCCACAGGCTGCAGAGAAGAAGGTGGCTGAAGCCAATCAGAAATA[T/G]TTCTCCAACATGGCTGAGTTCCTCAAGGTCAAGCGTGAGAAGGAGGACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link