
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ftr51
- Ensembl ID:
- ENSDARG00000029105
- ZFIN ID:
- ZDB-GENE-081104-54
- Description:
- FinTRIM family protein [Source:UniProtKB/TrEMBL;Acc:B5WY16]
- Human Orthologue:
- TRIM65
- Human Description:
- tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
- Mouse Orthologue:
- Trim65
- Mouse Description:
- tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa16228 | Nonsense | Available for shipment | Available now |
sa20313 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa16228
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000099920 | None | 285 | None | 4 | |
ENSDART00000132323 | Nonsense | 55 | 530 | 1 | 6 |
- Genomic Location (Zv9):
- Chromosome 4 (position 60401117)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 74907578 GRCz11 4 76488641 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GACTGCTGGGATCAGGAGGAGGAGAAGGGAGTCTACAGCTGCCCTCAGTG[C/A]AGACAGACCTTCAGTCYCAGACCYGCGCTAGCTAAAAACACCATCCTGGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20313
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000099920 | Nonsense | 173 | 285 | 3 | 4 |
ENSDART00000132323 | Nonsense | 248 | 530 | 3 | 6 |
- Genomic Location (Zv9):
- Chromosome 4 (position 60405275)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 74903420 GRCz11 4 76484483 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGAAGAGGATCTTCACTGAGCTCATCCAGCACATTGAGAGAAGCCGATCC[G/T]AGGTCACTCGGCAGATCCGAGATCAGGAGAAATCTGCCGTGAGTCGAGCT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- White matter hyperintensity burden: Genome-wide association studies of cerebral white matter lesion burden: the CHARGE consortium. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: